Comparison of qPCR versus culture for the detection and quantification of Clostridium difficile environmental contamination

Abstract

Contaminated surfaces serve as an important reservoir for Clostridium difficile transmission. Current strategies to detect environmental contamination of C. difficile rely heavily on culture, and often only indicate presence versus absence of spores. The goal of this study was to compare quantitative PCR (qPCR) to culture for the detection and quantification of C. difficile from inert surfaces. First, we compared the limit of detection (LOD) of a 16S rRNA gene and toxin B gene qPCR assay for detection of C. difficile in solution. Second, we compared the LODs of 16S rRNA gene qPCR versus culture for detection of C. difficile from surfaces. Solution experiments were performed by direct seeding of spores into neutralizing broth, whereas surface experiments involved seeding of spores onto plastic test surfaces, and recovery using sponge swabs. Both experiments were conducted using spores expressing short (NAP1) and long (NAP4) hair lengths. Combining data from both strains, the overall LOD for C. difficile cells in solution was 1.4 cells for 16S rRNA gene and 23.6 cells for toxin B gene qPCR (p<0.001). The overall LOD for C. difficile cells from surfaces was 17.1 cells for 16S rRNA gene qPCR and 54.5 cells for culture (p = 0.05), and was not statistically different between strains for each method (p = 0.52). Overall, the proportion of C. difficile cells recovered from surfaces was good when detected by 16S rRNA gene qPCR and culture (qPCR: 76%, culture: 67%, p = 0.36), but, 16S rRNA gene qPCR was capable of detecting lower levels of surface contamination. Future work attempting to measure the presence of C. difficile on environmental surfaces should consider using qPCR.

Clostridium perfringens enterotoxin induces claudin-4 to activate YAP in oral squamous cell carcinomas

“…Since the detection of Clostridium by culture methods is insufficient [42], we employed PCR-amplification of bacterial DNA to determine the frequency of Clostridium in oral flora. In general, Clostridium spp.…”

IL-17–producing γδ T cells protect against Clostridium difficile infection

“…In adult mice, we found that doses ranging from 1 × 10 4 to 1 × 10 6 CFU caused symptoms of C. difficile disease, including ruffled fur, hunched posture, and weight loss, with dose-dependent mortality ( Figure 1A). C. difficile intestinal burden was monitored by quantitative PCR (qPCR) analysis of the tcdB gene, as this approach is more sensitive than culturing (49) and detects endogenous strains of C. difficile found in some mouse strains (50,51). We found that C. difficile was absent in antibiotic-treated mice before infection, peaked on day 2, and then declined to nearly undetectable levels by day 8 after infection ( Figure 1B).…”

Oral Corticosteroids Impair Mucin Production and Alter the Posttransplantation Microbiota in the Gut

“…C. difficile, C. perfringens, and E. faecium were detected in the fecal samples as previously described [37][38][39]. For E. faecium, 2 ng of fecal DNA was amplified with SYBR Green (Qiagen), and Efm12 [37] primers (GAAAGGACACGATTCTACTTGCT and ATG-AACGGAGCCCATCAAACC) were reacted at 94°C for 10 min, followed by 40 cycles of 94°C for 15 s and 60°C for 1 min.…”

“…For E. faecium, 2 ng of fecal DNA was amplified with SYBR Green (Qiagen), and Efm12 [37] primers (GAAAGGACACGATTCTACTTGCT and ATG-AACGGAGCCCATCAAACC) were reacted at 94°C for 10 min, followed by 40 cycles of 94°C for 15 s and 60°C for 1 min. For C. difficile, primers and a probe (TTGAGCGATTTACTTCGGTA-AAGA, CCATCCTGTACTGGCTCACCT, and 6-FAM-CGGC-GGACGGGTGAGTAACG-MBG) [39] and qPCR Mastermix Plus (EUROGENTEC) were reacted at 50°C for 2 min and 95°C for 10 min, followed by 50 cycles of 95°C for 15 s and 60°C for 1 min. For C. perfringens, primers Clper [38] (GGGGGTTTCAA-CACCTCC and GCAAGGGATGTCAAGTGT) and SYBR Green were reacted at 95°C for 5 min, followed by 50 cycles of 94°C for 15 s and 60°C for 1 min.…”