Comparison of the expressed porcine Vβ and Jβ repertoire of thymocytes and peripheral T cells

Abstract

Summary Transcripts of more than 300 unique T‐cell receptor‐β (TCR‐β) V‐D‐J rearrangements recovered from porcine thymocytes and peripheral T cells were compared. We identified 19 groups (families) of porcine Vβ genes in seven supergroups and provisionally named 17 groups based on their sequence similarity with recognized human Vβ gene families. TRBV4S, 5S, 7S and 12S accounted for > 80% of all Vβ usage, and usage of these groups by thymocytes and peripheral T cells was highly correlated. No TRBV group was uniquely expressed in significant numbers in thymocytes, although small numbers of TRBV groups 2S, 9S and 15S were only recovered from T cells. Usage of Jβ segments from the 5′ D‐J‐C duplicon in thymocytes and peripheral T cells directly correlated with their 5′ position in the locus, and Jβ1·1, 1·2 and 1·3 accounted for ≥ 35% of all Jβ usage in both cell types. This contrasts with the usage of Jβ2 segments in that Jβ2·4, 2·5 and 2·7 accounted for ≈ 30% of Jβ usage by T cells and thymocytes. Jβ2·7 was threefold more frequent among T cells than thymocytes. The Vβ/Jβ combination was not random. Jβ1·1 and 1·2 were used in 29% of rearrangements with high frequency among the major Vβ groups. Combinations of TRBV4 and V12 with Jβ2·7 were only found in T cells and accounted for half of all Jβ2·7 usage. These studies show that unlike porcine heavy chain VH genes, the occurrence and relative usage of porcine TCR‐Vβ groups resembles that of humans. Thus, highly related gene systems can individually diverge within a species.

Antibody Repertoire Development in Fetal and Neonatal Pigs. VII. Characterization of the Preimmune κ Light Chain Repertoire

“…1B). A high level of sequence homology also exists between porcine and human MHC (41) as well as in the genomic organization of human and porcine MHC locus (42) and the TCRV␤ gene groups (43). These findings may suggest that 1) structural similarities are more related to lifestyle and presumably function; and 2) the phylogeny of individual systems may not follow species phylogeny.…”

Organization of lampreyvariable lymphocyte receptor Clocus and repertoire development

“…From a genomic standpoint, the incomplete germ-line VLRC gene serves as an equivalent of the constant gene segment, whereas the clusters of different types of donor genomic cassettes represent the functional correlates of the clusters of V, D, and J gene segments of Ig or TCR loci in jawed vertebrates (20)(21)(22). Interestingly, the donor LRRencoding cassettes are not used equally for VLR assembly, in analogy with the preferential use of certain V, D, and J segments in Ig/TCR recombinations in jawed vertebrates (23)(24)(25)(26).…”

Two Groups of Porcine TCRγδ+ Thymocytes Behave and Diverge Differently

“…First-strand cDNA synthesis was performed using 2 g of total RNA or total RNA prepared from the same amount of sorted cells and primed with 200 ng of random hexamer primer. Genes or gene segments of interest were amplified using previously described primer pairs (8,10,11). The only exceptions were primers for pT␣ (sense, ctgcagctgggtcctgcctc; antisense, agtctccgtggccgggtgca; designed to amplify all three spliced variants, pT␣1, pT␣2, and pT␣3), TCRV␣ (sense, tggtayvkmcagtaycc; antisense, tctcagctggtacacagc; designed to amplify the most frequently encountered subgroups, V␣01, V␣02, V␣03, and V␣14 (12)), and TCRC␣ (sense, gct gtgtaccagctgaga; antisense, agtttaggttcatatctg).…”