Comparison of the gating behaviour of human and murine cystic fibrosis transmembrane conductance regulator Cl⁻ channels expressed in mammalian cells

Abstract

To investigate the function of the murine cystic fibrosis transmembrane conductance regulator (CFTR), a full‐length cDNA encoding wild‐type murine CFTR was assembled and stably expressed in Chinese hamster ovary (CHO) cells. Like human CFTR, murine CFTR formed Cl− channels that were regulated by cAMP‐dependent phosphorylation and intracellular ATP. However, murine CFTR Cl− channels had a reduced single‐channel conductance and decreased open probability (Po) compared with those of human CFTR. Analysis of the dwell time distributions of single channels suggested that the reduced Po of murine CFTR was caused by both decreased residence in the open state and transitions to a new closed state, described by an intermediate closed time constant. For both human and murine CFTR, ATP and ADP regulated the rate of exit from the long‐lived closed state. 5′‐Adenylylimidodiphosphate (AMP‐PNP) and pyrophosphate, two compounds that disrupt cycles of ATP hydrolysis, stabilized the open state of human CFTR. However, neither agent locked murine CFTR Cl− channels open, although AMP‐PNP increased the Po of murine CFTR. The data indicate that although human and murine CFTR have many properties in common, some important differences in function are observed. These differences could be exploited in future studies to provide new understanding about CFTR.

A domain mimic increases ΔF508 CFTR trafficking and restores cAMP-stimulated anion secretion in cystic fibrosis epithelia

“…However, in contrast to the C127 cells, the absolute magnitude of the cAMP-induced ⌬I sc in the NBF1-expressing MGEF monolayers was approximately the same as in the MGEN monolayers expressing recombinant hCFTR. This variance may reflect differences in the activities of the recombinant vs. the endogenous CFTR channel or result from inherent differences in ⌬F508 CFTR properties between the two species (30). Interestingly, the basal I sc of the NBF1-expressing MGEF and MGEN cells was elevated compared with the Zeocinexpressing control monolayers.…”

Expression of CFTR from a ciliated cell-specific promoter is ineffective at correcting nasal potential difference in CF mice

“…Human and mouse CFTR share only 78% identity at the amino acid level, 35 and there are studies that have identified differences in channel properties between murine and human CFTR. 36 It has also been reported that the interaction of mouse and human CFTR with ENaC is species specific. 37 Thus it is possible that the human CFTR, due to sequence differences, does not function properly in mouse cells under all conditions.…”

Optimisation of real-time quantitative RT-PCR for the evaluation of non-viral mediated gene transfer to the airways

“…The TaqMan EmCFTR RT-PCR assay forward primer (5'-TCGTGATCACATCAGAAATT ATTGATAAT), reverse primer (5'-CCACCTCTCTCAA GTTTTCAATCAT) and fluorogenic probe (5'-CGCTGATTCCCAACAATATGCCTTAACAGAATA) detected endogenous murine CFTR mRNA. The EmCFTR RT-PCR forward primer hybridised to the region of the mCFTR cDNA previously mutated to remove a cryptic bacterial promoter, 6 in order to eliminate hybridisation to mCFTR sequences in the vector pCIKmCFTR.…”

“…The murine CFTR cDNA, isolated from the C57/B6 mouse strain (obtained from B Wainwright and D Lunn, University of Queensland, Brisbane, Australia), was supplied in plasmid pEFmCFTR. 6 The 5' region of the mCFTR cDNA was amplified by PCR from pEFmCFTR using Vent DNA polymerase (New England Biolabs (NEB), Hitchin, UK), and 500 nM forward (GGCTAGCCACCATGCAGAAGTCGCCTTGG) and reverse (CCAGTACTTTATACTCTTGTTTCTGCAGG) primers, and ligated into the plasmid pBluescript SK(Ϫ) (pBSKM) digested with SmaI, to produce pBSKM5' mCFTR. A 290 bp HindIII-SalI fragment of the plasmid pSL301 (Invitrogen, Leek, The Netherlands) multiple cloning site was isolated, and ligated into the low copy number plasmid pBR322 (NEB) digested with HindIII and SalI, to produce pBRSL.…”

“…2 The murine cftr gene (mCFTR) has also been cloned, 4,5 to human CFTR, 4,5 also functions as a cAMP-dependent epithelial chloride channel. 6 A proposed treatment for CF pulmonary disease is gene augmentation therapy, where the CFTR gene is introduced into the airways of CF individuals. Several aspects of CF pulmonary disease suggest that it may be a good candidate to be treated with gene therapy.…”