Comparison of Three DNA Extraction Methods for Feed Products and Four Amplification Methods for the 5′-Junction Fragment of Roundup Ready Soybean

Wang, Xiumin; Teng, Da; Tian, Fang; Guan, Qingxin; Wang, Jianhua

doi:10.1021/jf300827q

Cited by 37 publications

(19 citation statements)

References 35 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Similarly, the results of Herzallah (2012) showed that in Jordan, 5.4 % of the total food and feed tested samples were GM positive. The prevalence of GM materials in food and feed industries is the subject of ongoing studies in many countries (Tung-Nguyen et al 2009;Wang et al 2012;Herzallah 2012;Fernandes et al 2014). …”

Section: Resultsmentioning

confidence: 99%

“…DNA extraction methods The DNA extraction methods were chosen from those previously reported to be successful for food and feed products (Mafra et al 2008;Peano et al 2004;Smith et al 2007;Jasper et al 2009;Wang et al 2012). Total DNA was isolated with four commercial kits: Foodproof GMO Sample Preparation (Biotecon Diagnostics GmbH, Potsdam, Germany), DNeasy Plant Mini (Qiagen, Valencia, CA), Wizard (Promega, Madison, WI), and Genespin (GeneScan, Freiburg, Germany) as described by the manufacturers' instructions, and by the CTAB (Cetyltrimethylammonium bromide) method with some modifications, specifically adding RNase A (10 mg/mL) in the DNA precipitation step (Mafra et al 2008).…”

Section: Methodsmentioning

confidence: 99%

“…When method, matrix effects or interactions were significant, Duncan's multiple range test was applied to compare the significant differences at 95 % probability (Wang et al 2012). To estimate differences in amplificability of serial dilutions of extracted DNA, two-way ANOVA (α=0.05) was used to compare the calculated real-time PCR efficiencies, slopes and correlation coefficients (R 2 ) (Zel et al 2008).…”

Section: Methodsmentioning

confidence: 99%

See 2 more Smart Citations

DNA extraction techniques compared for accurate detection of genetically modified organisms (GMOs) in maize food and feed products

Türkeç

Kazan²,

Karacanli³

et al. 2014

J Food Sci Technol

View full text Add to dashboard Cite

In this paper, DNA extraction methods have been evaluated to detect the presence of genetically modified organisms (GMOs) in maize food and feed products commercialised in Turkey. All the extraction methods tested performed well for the majority of maize foods and feed products analysed. However, the highest DNA content was achieved by the Wizard, Genespin or the CTAB method, all of which produced optimal DNA yield and purity for different maize food and feed products. The samples were then screened for the presence of GM elements, along with certified reference materials. Of the food and feed samples, 8 % tested positive for the presence of one GM element (NOS terminator), of which half (4 % of the total) also contained a second element (the Cauliflower Mosaic Virus 35S promoter). The results obtained herein clearly demonstrate the presence of GM maize in the Turkish market, and that the Foodproof GMO Screening Kit provides reliable screening of maize food and feed products.

show abstract

Section: Resultsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

DNA extraction techniques compared for accurate detection of genetically modified organisms (GMOs) in maize food and feed products

Türkeç

Kazan²,

Karacanli³

et al. 2014

J Food Sci Technol

View full text Add to dashboard Cite

show abstract

“…The genomic DNA of NL‐11 was extracted by using the CTAB method (Wang et al , ), and the 16S rDNA coding region was amplified through PCR. The forward PCR primer was 27F (5′‐AGAGTTTGATCC/ATGGCTCAG‐3′), and the reverse PCR primer was 1492R (5′‐TACGGTTACCTTGTTACGACTT‐3′).…”

Section: Methodsmentioning

confidence: 99%

An Indigenous Soil Bacterium Facilitates the Mitigation of Rocky Desertification in Carbonate Mining Areas

Zhang

Guo

2017

Land Degrad Dev

View full text Add to dashboard Cite

Carbonate minerals are extensively distributed across China, and their special rock structures make them vulnerable to land damage through mining, leading to rocky desertification. Soil microorganisms play an important role in mineral weathering. However, little is known about the utilization of the mineral‐weathering microorganisms to alleviate the problem of rocky desertification in mines. In the present study, the mineral‐solubilizing bacterium NL‐11 was isolated from soil around weathered dolostones and identified as Bacillus thuringiensis based on the Biolog identification system and 16S rDNA sequence analysis. The mineral dissolution experiments revealed that inoculation with the live bacterium significantly increased the mineral sample dissolution via significantly enhancing Ca and Mg release, with increase values of 303·27 and 50·55 mg L−1 respectively, compared with that with the inactivated bacterium. Moreover, the acetic acid secreted by strain NL‐11 markedly decreased the size of particle diameter (quantified with a laser diffraction particle size analyser) through reducing pH value. The eroded traces were observed by scanning electron microscopy analysis, and the results further verified the erosional effects of this strain. In addition, this bacterium contributed to the establishment and proliferation of plants by providing nutrient elements, such as phosphorus (P) and potassium (K). Our study not only provided an efficient bacterial strain NL‐11 but also enriched the technologies to mitigate problems associated with ecological restorations of carbonate mines. Copyright © 2017 John Wiley & Sons, Ltd.

show abstract

“…Lines 1-9: 100 pb DNA pattern, negative control, conventional maize sample, 0.1%, 0.5%, 1.0%, 5.0% and 10.0% contamination with TC1507 transgenic maize and TC1507 sample. when compared to those of conventional PCR (WANG et al, 2012). For tests that require more precision, real time PCR is recommended over conventional PCR.…”

Section: Pcr Multiplexmentioning

confidence: 99%

Detection of transgenic events in maize using immunochromatographic strip test and conventional PCR

Cantelmo

Pinho

et al. 2013

Ciênc. agrotec.

View full text Add to dashboard Cite

With the growth in the transgenic market, fast and economically viable methodologies are necessary for undertaking transgene detection tests, both for identification of contamination in seeds and in grain. Seeds from commercial conventional GNZ 2004, and transgenic VT-Pro (MON89034), Roundup Ready (NK603) and Herculex (TC1507) maize cultivars were used. In order to simulate different levels of contamination, the transgenic seeds were mixed with conventional seeds at levels of 0.2%, 0.4%, 1.0% and 1.6% for VT-Pro, and 0.2%, 0.5%, 0.8% and 1.2% for Roundup Ready and Herculex. The lateral flow membrane strip test was performed in the whole seed, endosperm and embryo. For evaluation of the specificity of the technique in detection of the TC1507 event by means of the conventional PCR technique, seeds of the commercial maize hybrid GNZ 2004 were used as negative control, and the maize hybrid 2B655Hx as positive control. In order to simulate different levels of contamination, transgenic seeds were mixed with conventional seeds at the levels of 10%, 5%, 1%, 0.5% and 0.1%. Seeds from each sample were crushed, and then DNA extraction was performed by the CTAB 2% method. Using the immunochromatographic strip, it was possible to evaluate the expression of proteins related to the VT-Pro, Roundup Ready and Herculex events when whole seeds were used at the 0.2% level of contamination, whereas by the conventional PCR technique, it was possible to detect the TC1507 event in samples with 1% contamination.Index terms: Fast testing, contamination, specificity, transgenesis. RESUMOCom o crescimento do mercado de transgênicos, fazem-se necessárias metodologias rápidas e economicamente viáveis para detecção de transgenes, tanto para a identificação de contaminação em sementes quanto em grãos. Foram utilizadas sementes de cultivares comerciais de milho GNZ 2004 convencional, VT-Pro (MON89034), Round up Ready -RR (NK603) e Herculex (TC1507). Afim de simular diferentes níveis de contaminação, sementes transgênicas foram misturadas às sementes convencionais, nos níveis de 0,2%, 0,4%, 1,0% e 1,6%, para VT-Pro e 0,2%, 0,5%, 0,8% e 1,2%, para RR e Herculex. O teste de tiras foi realizado em semente inteira, endosperma e embrião. Para a avaliação da especificidade da técnica na detecção do evento TC1507, por meio da técnica de PCR convencional, foram utilizadas, como controle negativo, sementes do híbrido comercial de milho GNZ 2004 e, como controle positivo, o híbrido de milho 2B655Hx. Com a finalidade de simular diferentes níveis de contaminação, sementes transgênicas (TC1507) foram misturadas às sementes convencionais, nos níveis de 10%, 5%, 1%, 0,5% e 0,1%. Sementes de cada amostra foram trituradas e foi realizada a extração do DNA pelo método CTAB 2%. Utilizando-se a tira imunocromatográfica, foi possível avaliar a expressão de proteínas referente aos eventos VT-Pro, RR e Herculex, quando da utilização de sementes inteiras com níveis de contaminação de 0,2%. Foi possível, pela técnica de PCR convencional, detectar o evento TC1507...

show abstract

Comparison of Three DNA Extraction Methods for Feed Products and Four Amplification Methods for the 5′-Junction Fragment of Roundup Ready Soybean

Cited by 37 publications

References 35 publications

DNA extraction techniques compared for accurate detection of genetically modified organisms (GMOs) in maize food and feed products

DNA extraction techniques compared for accurate detection of genetically modified organisms (GMOs) in maize food and feed products

An Indigenous Soil Bacterium Facilitates the Mitigation of Rocky Desertification in Carbonate Mining Areas

Detection of transgenic events in maize using immunochromatographic strip test and conventional PCR

Contact Info

Product

Resources

About