Comparison of Three Real-Time PCR Assays for the Detection of Cyclospora cayetanensis in Stool Samples Targeting the 18S rRNA Gene and the hsp70 Gene

Abstract

Diagnostic real-time PCR for the detection of Cyclospora cayetanensis in human stool samples has been applied for two decades. However, recent comparative assessments between in-house and commercial assays suggested room for improvement regarding the agreement of positive signals of the applied real-time PCRs. In order to assess the effect of the choice of the target sequence, 3 inhouse real time PCR assays targeting the 18S rRNA gene (n = 2, one of them later referred to as SSU rRNA gene assay to avoid confusion) and the hsp70 gene of C. cayetanensis were compared in a head-to-head comparison with 905 samples with high pretest probability for C. cayetanensis infections from Ghanaian HIV patients in a test comparison without a reference standard. Only slight agreement kappa of 0.095 was observed. In the assays targeting the SSU rRNA gene, the 18S rRNA gene, and hsp70, positive signals were recorded in 63, 45, and 0 instances, respectively, with latent class analysis-based estimation of sensitivity of 32.2%, 23.3%, 0% as well as of specificity of 99.7%, 99.9% and 100%, respectively. High cycle threshold values with an average of about 35 indicated low quantities of target DNA in the samples with similar Ct values in concordantly and discordantly positive samples. In conclusion, the study suggested target-gene-specific differences in the diagnostic accuracy of real-time PCR-based diagnosis of C. cayetanensis as well as an ongoing need for further standardization of this diagnostic approach.

The Clinical Features and Immunological Signature of Cyclospora cayetanensis Co-Infection among People Living with HIV in Ghana

“…The differences in prevalence observed in the various studies may reflect differences in relative proportions of cART exposure in the HIV cohort, diagnostic techniques utilized (microscopy or molecular approaches such as PCR), prophylactic use of co-trimoxazole and perhaps also the level of sanitation in the various countries where these studies were conducted. In the present study, the presence of C. cayetanensis was assessed using an in-house real-time PCR targeting the small subunit ribosomal RNA (SSU rRNA) gene of C. cayetanensis [ 19 ]. In a previous head-to-head-comparison of described C. cayetanensis -specific real-time PCR assays, the applied approach was confirmed to be particularly sensitive for the identification of C. cayetanensis in human stool samples [ 19 ].…”

“…In the present study, the presence of C. cayetanensis was assessed using an in-house real-time PCR targeting the small subunit ribosomal RNA (SSU rRNA) gene of C. cayetanensis [ 19 ]. In a previous head-to-head-comparison of described C. cayetanensis -specific real-time PCR assays, the applied approach was confirmed to be particularly sensitive for the identification of C. cayetanensis in human stool samples [ 19 ].…”

“…A recent study comparing PCR assays for the detection of Cyclospora cayetanensis in stool samples demonstrated differences in the sensitivity of the tests evaluated [ 19 ]. Consequently, comparisons of detection rates across studies using different diagnostic methods should be made cautiously.…”

“…The run conditions were activation at 95 °C for 15 min, 45 cycles of 15 s denaturation at 95 °C, followed by a touchdown for the 30-second-long combined annealing and elongation step from 72 °C to 67 °C over 13 cycles in 0.5 °C steps, with final cooling down to 40 °C for an additional 30 s at the end of the run. As estimated in previous studies, calculated sensitivity for the C. cayetanensis -specific real-time PCR ranges from 32.0% to 81.8%, specificity from 98.7% to 99.7% with a limit of detection of less than 10 copies per µL eluate [ 18 , 19 ]. All runs included a PCR-grade-water-based negative control and positive control with a plasmid containing the target sequence 5′-GATTCATAGTAACCGAACGGATCGCATTTGGCTTTAGCCGGCGATAGATCATTCAAGTTTCTGACCTATCAGCTTTCGACGGTAGGGTATTGGCCTACCGTGGCATTGACGGG-3′.…”

Comparative Evaluation of Real-Time Screening PCR Assays for Giardia duodenalis and of Assays Discriminating the Assemblages A and B

“…The study was conducted as a comparative head-to-head assessment of different real-time-PCR assays with historical residual sample materials without microscopic characterization. For the comparison of the screening PCR assays targeting G. dudodenalis , residual volumes of nucleic acid extractions from stool samples of 905 Ghanaian HIV patients from previous epidemiological and technical assessments [ 38 , 39 , 40 , 41 , 42 , 43 ] were used, so an acceptable pre-test probability due to a high prevalence of giardiasis in Ghana could be assumed [ 44 , 45 ]. All available residual sample materials with sufficient volumes were included.…”