Competing hypotheses for the etiology of cryptorchidism in Sitka black‐tailed deer: an evaluation of evolutionary alternatives

Abstract

On the Aliulik Peninsula (AP) of Kodiak Island, Alaska, 70% of male Sitka blacktailed deer (SBTD; Odocoileus hemionus sitkensis) are bilaterally cryptorchid (both testes fail to descend; male is sterile). Both genetic and environmental factors have been proposed as possible causes of this problem. We investigated the possibility that population genetic processes (isolation, inbreeding and genetic drift) have contributed to an increased frequency of cryptorchidism in this population. Overall, SBTD on major islands throughout Alaska have unusually low levels of genetic diversity, though we identified a likely glacial refugium on Prince of Wales Island in the Alexander Archipelago. Within the Kodiak Archipelago, deer on the AP did not exhibit the patterns of genetic isolation, inbreeding and drift that would be expected if cryptorchidism in this population was the result of a founder mutation(s). Instead, our data favor exposure to environmental contaminants as a likely alternative mechanism causing high prevalence of cryptorchidism on the AP.

Species‐wide phylogeography of North American mule deer (Odocoileus hemionus): cryptic glacial refugia and postglacial recolonization

“…A northern refugium in or around Prince of Wales Island has been suggested for black‐tailed deer (Cronin et al . 1991; Latch et al . 2008), and seemed feasible given the Pleistocene presence of other mammals in this region.…”

“…Polymerase chain reaction (PCR) and sequencing conditions for control region primers (Odh‐dLoopF 5′‐GAGCAACCAATCTCCCTGAG‐3′/Odh‐dLoopR 5′‐ GTGTGAGCATGGGCTGATTA‐3′) are described in Latch et al . (2008).…”

“…(2008). For cytochrome b primers (Odh‐cytbF‐14153 5′‐TCAATGACCAACATCCGAAA‐3′/Odh‐cytbR‐15399 5′‐GGGTGTTGATAGTGGGGCTA‐3′), similar conditions to those of Latch et al . (2008) were used, except that the amount of genomic DNA in each PCR was decreased to 5 ng and the annealing temperature for each PCR was increased to 63 °C.…”

Homosexuality as a Consequence of Epigenetically Canalized Sexual Development

“…Also like homosexuality being elevated in individuals with loss of function at the CYP21 gene (but this gene not being a major cause of female homosexuality), extensive genetic studies have found that while loss of function at some candidate genes can lead to both hypospadias and cryptorchidism, the majority of cases are not associated with any known mutations (reviewed in Bay et al 2011;Kalfa et al 2011). Further evidence for a substantial nongenetic contribution in the case of cryptorchidism is: higher concordance (twofold) between dizygotic twins than that between singleton brothers (Jensen et al 2010); and the high incidence of cryptorchidism (up to 70%) observed in some isolated wildlife populations despite no genetic evidence for inbreeding or a founder effect-presumably due to an environmental hormone-signaling disruptor (Latch et al 2008).…”

Intersexuality in a crab-eating fox (Cerdocyon thous)

“…These pathologies are considered to be extremely rare in domestic animals (Mattos et al 2001), with few cases reported in carnivores (Bloom 1954, Reis 1966, Lyle 2007. However, the cryptorchidism has been reported in wild mammals, and it is probable a strong association with environmental contamination or consanguinity (Burton & Ramsay 1986, Dumbar et al 1996, Michalski et al 2001, Buergelt et al 2002, Mansfield & Land 2002, Latch et al 2008. However, to our knowledge, the total absence of gonads in a wild mammal has not been reported, yet.…”