Complete Genome Sequence of Aureimonas sp. Strain OT7, Isolated from Human Skin

Abstract

Aureimonas sp. strain OT7 was isolated from human skin. This strain can grow on Triton X-100. Here, we present the complete whole-genome sequence of this species, which has one chromosome of 4,181,223 bp (G+C content, 65.05%). Analysis of the Aureimonas sp. strain OT7 genome sequence indicated potential for autotrophic growth.

Genomic Characterization of Aureimonas altamirensis C2P003—A Specific Member of the Microbiome of Fraxinus excelsior Trees Tolerant to Ash Dieback

“…OT7, supported by high bootstrap values (Figure S1). Strain OT7, isolated from human skin, and strain ON-56566, isolated from patient blood culture, were reported to belong to the same species clade that is separated from the A. altamirensis type strain [41]. Consistent with the 16S rRNA data, a phylogenomic analysis indicated that A. frigidaquae and "A. fodinaquatilis" were the species most closely related to A. altamirensis.…”

“…The four strains of environmental origin formed a shared cluster that was distinct from the isolates detected in clinical samples [31,32,37,38,41]. Within the genus, A. frigidaquae and "A. fodinaquatilis" were found to be the closest related species.…”

“…Consistent with the 16S rRNA data, a phylogenomic analysis indicated that A. frigidaquae and "A. fodinaquatilis" were the species most closely related to A. altamirensis. The four strains of environmental origin formed a shared cluster that was distinct from the isolates detected in clinical samples [31,32,37,38,41]. Within the genus, A. frigidaquae and "A. fodinaquatilis" were found to be the closest related species.…”

Genome Sequences of Metabacillus sp. Strain B2-18, Isolated from Human Skin, and Metabacillus endolithicus KCTC 33579 T

“…Ethical approval for subject sampling was granted by the institutional review board of Changwon National University. Sanger sequencing of the 16S rRNA gene amplicon with primers 27F (5′- AGAGTTTGATCCTGGCTCAG -3′) and 1492R (5′- GGTTACCTTGTTACGACTT -3′) ( 3 ) yielded unidentifiable overlapping peaks with partially recognizable nucleotide sequences at the 5′ and 3′ ends. The amplification conditions were the same as those described previously ( 4 ).…”

Genome Sequences of the Human-Skin-Originated Brevundimonas albigilva TT17 and the Soil-Originated B. albigilva KEME 9005-016 T

“…Ethical approval for subject sampling was granted by the institutional review board of Changwon National University. Sanger sequencing of the 16S rRNA gene ( 4 ) using the V1 to V9 region (i.e., with primers 27F and 1492R) enabled the identification of TT17 as belonging to the genus Brevundimonas .…”