Complete Genome Sequence of the WHO International Standard for Hepatitis B Virus DNA

Jenkins, Adrian; Minhas, Rehan; Morris, Clare; Berry, Neil

doi:10.1128/genomea.01576-16

Cited by 7 publications

(4 citation statements)

References 4 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…This highlights that the assays used to detect immunity to MuV may not always detect an adequate post-vaccination response. Only a small number of serological commercial assays such as the detection of Hepatitis B surface antibody (anti-HBs) ( 221 ) and rubella IgG ( 222 ) have been designed using WHO reference material as a standard for quantification. However, even utilizing this reference standard demonstrates significant differences in the determined quantification of either anti-HBs or rubella IgG depending on the assays used; although a value for anti-HBs of 10 IU/ml is regarded as protective against significant HBV infection, the detection of this anti-HBs is significantly influenced by which anti-HBs assays is used ( 223 – 227 ).…”

Section: Laboratory Determinants Of An Effective Immune Response To Mmentioning

confidence: 99%

Mumps Outbreaks in Vaccinated Populations—Is It Time to Re-assess the Clinical Efficacy of Vaccines?

Connell

Leahy

et al. 2020

Front. Immunol.

View full text Add to dashboard Cite

History illustrates the remarkable public health impact of mass vaccination, by dramatically improving life expectancy and reducing the burden of infectious diseases and co-morbidities worldwide. It has been perceived that if an individual adhered to the MMR vaccine schedule that immunity to mumps virus (MuV) would be lifelong. Recent mumps outbreaks in individuals who had received two doses of the Measles Mumps Rubella (MMR) vaccine has challenged the efficacy of the MMR vaccine. However, clinical symptoms, complications, viral shedding and transmission associated with mumps infection has been shown to be reduced in vaccinated individuals, demonstrating a benefit of this vaccine. Therefore, the question of what constitutes a good mumps vaccine and how its impact is assessed in this modern era remains to be addressed. Epidemiology of the individuals most affected by the outbreaks (predominantly young adults) and variance in the circulating MuV genotype have been well-described alluding to a collection of influences such as vaccine hesitancy, heterogeneous vaccine uptake, primary, and/or secondary vaccine failures. This review aims to discuss in detail the interplay of factors thought to be contributing to the current mumps outbreaks seen in highly vaccinated populations. In addition, how mumps diagnoses has progressed and impacted the understanding of mumps infection since a mumps vaccine was first developed, the limitations of current laboratory tests in confirming protection in vaccinated individuals and how vaccine effectiveness is quantified are also considered. By highlighting knowledge gaps within this area, this state-of-the-art review proposes a change of perspective regarding the impact of a vaccine in a highly vaccinated population from a clinical, diagnostic and public perspective, highlighting a need for a paradigm shift on what is considered vaccine immunity.

show abstract

Section: Laboratory Determinants Of An Effective Immune Response To Mmentioning

confidence: 99%

Mumps Outbreaks in Vaccinated Populations—Is It Time to Re-assess the Clinical Efficacy of Vaccines?

Connell

Leahy

et al. 2020

Front. Immunol.

View full text Add to dashboard Cite

show abstract

“…We elected to target a conserved region of the HBV polymerase gene for the development of the SQLA assay using the WHO International Standard HBV genome 23 (GenBank accession no. KY003230).…”

Section: ■ Results and Discussionmentioning

confidence: 99%

Tunable Duplex Semiquantitative Detection of Nucleic Acids with a Visual Lateral Flow Immunoassay Readout

2022

View full text Add to dashboard Cite

Quantitative nucleic acid amplification testing (NAAT) is a key enabling technology for infectious disease management, especially in instances where viral load informs therapeutic decisions. Inadequate access to quantitative NAATs remains a challenge to the successful deployment of antiretroviral therapy (ART) regimens for patients with chronic hepatitis B virus (CHB) in low resourced settings (LRS). Current field-deployable NAATs are generally qualitative (yes/no) rather than quantitative in nature, making them ill-suited for viral load monitoring programs for CHB patients. Here, we report the development of a proof-of-concept molecular diagnostic test, the semiquantitative ligation and amplification (SQLA) assay, which achieves semiquantitative detection of input target DNA at two independently tunable detection thresholds with a simple visual readout. The SQLA assay utilizes a duplex competitive thermophilic helicase-dependent amplification (tHDA) chemistry and can be performed in under 1 h.

show abstract

“…The HBV DNA was amplified by Nested PCR of the surface antigen gene using specific primers. The sequences of the outer primers were HBV179FS, CTAG-GACCCCTGCTCGTGTT as the outer sense, and HBV704RS, CGAACCACTGAACAAATGGCACT as the outer anti-sense; 251f, GACTYGTGGTGGACTTCTC as the inner sense; 654r, GSCCCAMBCCCATAGG as the inner antisense primer 16 synthesized by Metabion Company, Germany. Concisely, Nested PCR amplification for the first round was carried out in a total volume of 25 mL, containing 2.5 mL PCR buffer, 0.5 mL dNTP, 1 mL MgCl 2 , 1 mL of outer primers, 0.8 mL DNA Taq polymerase, 2.5 mL Template DNA, and 15.7 mL nuclease-free water In the second round, 1 mL product of the first round was used as a template, 2.5 mL PCR buffer, 0.5 mL dNTP, 1 mL MgCl 2 , 1 mL of inner primers, 0.8 mL DNA Taq polymerase, and 17.2 mL nuclease-free water was mixed to reach the final 25 mL volume.…”

Section: Methodsmentioning

confidence: 99%

Occult Hepatitis B Virus Infection among β-Thalassemia Major Patients in Ahvaz City, Iran

Amirhashchi

Azaran

Seyedian

et al. 2022

The American Journal of Tropical Medicine and Hygiene

View full text Add to dashboard Cite

Occult Hepatitis B Infection (OBI) is a critical risk factor for triggering post-transfusion hepatitis (PTH), cirrhosis, hepatocellular carcinoma, and hepatitis B virus (HBV) reactivation, which β-thalassemia major (BTM) patients are at risk of it due to multiple blood transfusions. This study was aimed at determining the prevalence of OBI among BTM patients from Khuzestan Province, Iran. In this cross-sectional study, 90 thalassemia patients, who have received blood 36 to 552 times, participated referred to the Shafa hospital of Ahvaz city from January 2018 to April 2019. ELISA for determining serological markers (HBsAg, anti-HBc, anti-HBs, and anti-HCV) and real-time PCR for detecting HBV-DNA were performed; Nested PCR was conducted for DNA sequencing and determining the genotype of OBI case. Phylogenetic and statistical analyses were done by R package. Of 90 subjects enrolled in this study; 95.5% (86/90) were HBsAg negative, and the frequency of OBI among them was 1.16% (1/86). The anti-HBs, anti-HBc, and anti-HCV were detected in 80.00%, 7.78%, and 12.2% of patients, respectively. HBV-DNA was assessed at four HBsAg-positive subjects as well, and all of them were negative. The phylogenetic analysis showed that the detected HBV DNA in the OBI case belongs to the genotype D. This research, for the first time, demonstrated that OBI is present among β-thalassemia patients in Iran. Also, further studies are necessary to determine the actual prevalence of OBI among BTM patients in Iran to decisions concerning OBI screening, especially in transfusion centers.

show abstract

Complete Genome Sequence of the WHO International Standard for Hepatitis B Virus DNA

Cited by 7 publications

References 4 publications

Mumps Outbreaks in Vaccinated Populations—Is It Time to Re-assess the Clinical Efficacy of Vaccines?

Mumps Outbreaks in Vaccinated Populations—Is It Time to Re-assess the Clinical Efficacy of Vaccines?

Tunable Duplex Semiquantitative Detection of Nucleic Acids with a Visual Lateral Flow Immunoassay Readout

Occult Hepatitis B Virus Infection among β-Thalassemia Major Patients in Ahvaz City, Iran

Contact Info

Product

Resources

About