Complete Genome Sequences of Two Helicobacter pylori Bacteriophages Isolated from Japanese Patients

Uchiyama, Jumpei; Takeuchi, Hiroaki; Kato, Shin‐ichiro; Takemura‐Uchiyama, Iyo; Ujihara, Takako; Daibata, Masanori; Matsuzaki, Shigenobu

doi:10.1128/jvi.01767-12

Cited by 40 publications

(44 citation statements)

References 13 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Phage KHP30 has a double-stranded DNA (dsDNA) genome (16). Spherical phages with dsDNA often contain lipids inside the phage particles (53), and so they seemed to have a smaller genomic DNA size relative to the particle volume than the tailed phages.…”

Section: Resultsmentioning

confidence: 99%

“…We have recently isolated phage KHP30 from the culture supernatant of an East Asian H. pylori strain, NY43, isolated from a patient at Yamaguchi University Hospital in Japan, and have reported its genomic sequence (16). To extend our understanding of the contribution of phages to H. pylori evolution, the biological characteristics of the H. pylori phages must be examined.…”

mentioning

confidence: 99%

“…When the orf14 sequence of phage KHP30 was compared with sequences in the NCBI database using BLASTn, orf14-like sequences were not found on the DNA sequences intrinsic to H. pylori, although they were found on putative phage DNA sequences integrated into the genomes in some H. pylori strains. A primer set (primers ORF14F [GGTATAGAAGTTGGTAGAGAGATCC] and ORF14R [CCATATCAGACACTAAACCGATCACG]) was designed on the basis of the orf14 sequence in the phage KHP30 genome (16), and the orf14 fragment was amplified by PCR using the phage DNA as a template. The phage DNA was obtained, as described below in "Restriction digestion analysis of phage DNAs."…”

mentioning

confidence: 99%

“…Phage KHP30 was isolated previously (16). Briefly, phage KHP30 was isolated from the culture supernatant of H. pylori strain NY43 with three rounds of single-plaque isolation in double-layered agar containing H. pylori strain 3401.…”

mentioning

confidence: 99%

See 3 more Smart Citations

Characterization of Helicobacter pylori Bacteriophage KHP30

Uchiyama

Takeuchi

Kato

et al. 2013

Appl Environ Microbiol

Self Cite

View full text Add to dashboard Cite

Helicobacter pylori inhabits the stomach mucosa and is a causative agent of stomach ulcer and cancer. In general, bacteriophages (phages) are strongly associated with bacterial evolution, including the development of pathogenicity. Several tailed phages have so far been reported in H. pylori. We have isolated an H. pylori phage, KHP30, and reported its genomic sequence. In this study, we examined the biological characteristics of phage KHP30. Phage KHP30 was found to be a spherical lipid-containing phage with a diameter of ca. 69 nm. Interestingly, it was stable from pH 2.5 to pH 10, suggesting that it is adapted to the highly acidic environment of the human stomach. Phage KHP30 multiplied on 63.6% of clinical H. pylori isolates. The latent period was ca. 140 min, shorter than the doubling time of H. pylori (ca. 180 min). The burst size was ca. 13, which was smaller than the burst sizes of other known tailed or spherical phages. Phage KHP30 seemed to be maintained as an episome in H. pylori strain NY43 cells, despite a predicted integrase gene in the KHP30 genomic sequence. Seven possible virion proteins of phage KHP30 were analyzed using N-terminal protein sequencing and mass spectrometry, and their genes were found to be located on its genomic DNA. The genomic organization of phage KHP30 differed from the genomic organizations in the known spherical phage families Corticoviridae and Tectiviridae. This evidence suggests that phage KHP30 is a new type of spherical phage that cannot be classified in any existing virus category. Helicobacter pylori, a Gram-negative spiral bacterium, colonizes the human stomach mucosa (1). It causes chronic inflammation, which may progress to peptic ulceration, atrophic gastritis, and gastric cancer (2). Recent studies of H. pylori have revealed that the pathogenicity of H. pylori strains is related to the specific geographic region from which they derive (3, 4). An East Asian type of H. pylori strain most likely causes gastric cancer and highly likely contains cytotoxin-associated gene A (cagA), a carcinogenic genetic element (1, 3). However, how the pathogenicity of the H. pylori strains has evolved is unknown, although H. pylori inhabits a very restricted niche in the stomach mucosa. Therefore, the factors involved in H. pylori evolution must be investigated.Bacteriophages (phages) are the most diverse and abundant life form on Earth. Phages practice lateral gene transfer and are involved in a coevolutionary arms race with bacteria (5-8), so they may well be factors involved in bacterial evolution. Several H. pylori phages have been reported (9-13), and some of these have been morphologically studied and have been found to belong to the order Caudovirales (i.e., the tailed phages) (9-12). Recent advances in sequencing technologies have allowed intensive genomic analyses of Helicobacter spp. and have also suggested the presence of phages in the bacterial genome (10,11,14,15). However, the biological characteristics of these H. pylori phages are not well-known.We have recently iso...

show abstract

Section: Resultsmentioning

confidence: 99%

mentioning

confidence: 99%

mentioning

confidence: 99%

mentioning

confidence: 99%

See 2 more Smart Citations

Characterization of Helicobacter pylori Bacteriophage KHP30

Uchiyama

Takeuchi

Kato

et al. 2013

Appl Environ Microbiol

Self Cite

View full text Add to dashboard Cite

show abstract

“…This diversity can be attributed to altered DNA repair, elevated mutation rates, high frequency of intraspecific recombination, chromosomal DNA transfer events from other species, incorporation of naked DNA from the environment, plasmid mobilization, and integration of acquired DNA in the so-called plasticity zones [4,[8][9][10]. In addition, the presence of phages has been described for several H. pylori strains, acting as another source of bacterial diversity and evolution [11][12][13][14][15]. Using newly developed bioinformatics programs, recent comparative studies of 29 complete genome sequences of strains from different parts of the world revealed a high-resolution picture of the H. pylori population structure as well as the extent and direction of genetic flux between subgroups of the bacterium [16].…”

Section: Introductionmentioning

confidence: 99%

DNA transfer in the gastric pathogen Helicobacter pylori

Fernández-González

Backert

2014

J Gastroenterol

View full text Add to dashboard Cite

The gastric pathogen Helicobacter pylori is one of the most genetically diverse bacteria. Recombination and DNA transfer contribute to its genetic variability and enhance host adaptation. Among the strategies described to increase genetic diversity in bacteria, DNA transfer by conjugation is one of the best characterized. Using this mechanism, a fragment of DNA from a donor cell can be transferred to a recipient, always mediated by a conjugative nucleoprotein complex, which is evolutionarily related to type IV secretion systems (T4SSs). Interestingly, the H. pylori chromosomes can encode up to four T4SSs, including the cagPAI, comB, tfs3, and tfs4 genes, some of which are known to promote chronic H. pylori infection. The T4SS encoded by the cagPAI mediates the injection of the effector protein CagA and proinflammatory signaling, and the comB system is involved in DNA uptake from the environment. However, the role of tfs3 and tfs4 is not yet clear. The presence of a functional XerD tyrosine recombinase and 5 0 AAAGAATG-3 0 border sequences as well as two putative conjugative relaxases (Rlx1 and Rlx2), a coupling protein (TraG), and a chromosomal region carrying a putative origin of transfer (oriT) suggest the existence of a DNA transfer apparatus in tfs4. Moreover, a conjugation-like DNA transfer mechanism in H. pylori has already been described in vitro, but whether this occurs in vivo is still unknown. Some extrachromosomal plasmids and phages are also present in various H. pylori strains. Genetic exchange among plasmids and chromosomes, and involved DNA mobilization events, could explain part of H. pylori's genetic diversity. Here, we review our knowledge about the possible DNA transfer mechanisms in H. pylori and its implications in bacterial adaptation to the host environment.

show abstract

Isolation of Bacteriophages for Fastidious Bacteria

Matsuzaki

Uchiyama

Takemura‐Uchiyama

et al. 2017

Methods in Molecular Biology

View full text Add to dashboard Cite

One of the most important factors for successful bacteriophage therapy is, undoubtedly, the isolation of excellent therapeutic candidate bacteriophages. There are only a few reports about active bacteriophages in the fastidious bacteria Helicobacter pylori. In this chapter, we describe a method for isolating and purifying KHP30-like bacteriophages in H. pylori, which have lytic and pseudolysogenic life cycles.

show abstract

Complete Genome Sequences of Two Helicobacter pylori Bacteriophages Isolated from Japanese Patients

Cited by 40 publications

References 13 publications

Characterization of Helicobacter pylori Bacteriophage KHP30

Characterization of Helicobacter pylori Bacteriophage KHP30

DNA transfer in the gastric pathogen Helicobacter pylori

Isolation of Bacteriophages for Fastidious Bacteria

Contact Info

Product

Resources

About