Complete mitochondrial genome of the H3 haplotype Argentine ant <i>Linepithema humile</i> (Mayr, 1868) (Formicidae; Hymenoptera)

Park, Jong‐Hyun; Park, Chan Ho; Park, Jongsun

doi:10.1080/23802359.2021.1882900

Cited by 6 publications

(7 citation statements)

References 21 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…In addition, all branches except one (see grey arrow in Figure 6) were supported by the high supportive values of both trees (Figure 1), displaying a rigid phylogenetic relationship within the family Delphacidae. This is congruent with the previous phylogenetic studies [46,100,101], supporting that the phylogenetic relationship of the 30 Delphacidae species become more supportive in comparison to the incongruent cases of molecular phylogeny based on between marker sequences and complete mitogenomes [102][103][104]. The exceptional clade displaying low supportive values of ML (52; Figure 7) was also presented lower supportive values of both ML and BI trees (Clade III) in the previous phylogenetic study [46].…”

Section: Phylogenetic Tree Of 32 Delphacidae Mitogenomes Including Three Wbph Mitogenomessupporting

confidence: 88%

A New Mitochondrial Genome of Sogatella furcifera (Horváth) (Hemiptera: Delphacidae) and Mitogenome-Wide Investigation on Polymorphisms

Park¹,

Xi²,

Park³

et al. 2021

Insects

Self Cite

View full text Add to dashboard Cite

White-backed planthopper (WBPH), Sogatella furcifera (Horváth), is one of the major sap-sucking rice pests in East Asia. We have determined a new complete mitochondrial genome of WBPH collected in the Korean peninsula using NGS technology. Its length and GC percentages are 16,613 bp and 23.8%, respectively. We observed one polymorphic site, a non-synonymous change, in the COX3 gene with confirmation heteroplasmy phenomenon within individuals of WBPH by PCR amplification and Sanger sequencing, the first report in this species. In addition, this heteroplasmy was not observed in wild WBPH populations, suggesting that it may be uncommon in fields. We analyzed single nucleotide polymorphisms, insertion, and deletions, and simple sequence repeats among the three WBPH mitogenomes from Korea and China and found diverse intraspecific variations, which could be potential candidates for developing markers to distinguish geographical populations. Phylogenetic analysis of 32 mitogenomes of Delphacidae including the three WBPH mitogenomes suggested that Delphacinae seems to be monophyletic and Sogatella species including WBPH are clearly formed as one clade. In the future, it is expected that complete mitogenomes of individuals of geographically dispersed WBPH populations will be used for further population genetic studies to understand the migration pathway of WBPH.

show abstract

Section: Phylogenetic Tree Of 32 Delphacidae Mitogenomes Including Three Wbph Mitogenomessupporting

confidence: 88%

A New Mitochondrial Genome of Sogatella furcifera (Horváth) (Hemiptera: Delphacidae) and Mitogenome-Wide Investigation on Polymorphisms

Park¹,

Xi²,

Park³

et al. 2021

Insects

Self Cite

View full text Add to dashboard Cite

show abstract

“…The cytochrome c oxidase subunit I ( COI ) gene was used for species identification and haplotype confirmation, using the mitochondrial DNA of L. humile . The primer sets used to amplify COI were LCO1490 (5′‐GGTCAACAAATCATAAAGATATTGG‐3′) and HCO2198 (5′‐TAAACTTCAGGGTGACCAAAAAATCA‐3′) (Folmer et al 1994; Park J et al 2021). Polymerase chain reaction (PCR) was performed to amplify the COI gene using a COI gene primer set (AccuPower HotStart PCR Premix Kit; Bioneer, Daedeok‐gu, Daejeon, Republic of Korea).…”

Section: Methodsmentioning

confidence: 99%

Analysis of whole‐genome changes and characteristics of Linepithema humile (Hymenoptera: Formicidae) in the Republic of Korea

Jung,

Kim,

Kim

2023

Entomological Research

View full text Add to dashboard Cite

The Argentine ant, Linepithema humile (Mayr, 1868), native to the Paraguay River in South America, was first discovered in Korea in 2019. With increasing reports of L. humile, its genetic variation according to domestic growth colonies and its effects on the domestic ecosystem should be studied. Here, the genomes of L. humile specimens found at three locations in Busan were analyzed for genetic changes. First, morphological observation of L. humile samples collected from the three sites showed no phenotypic differences among them. Next, single‐nucleotide polymorphism (SNP)/insertion and deletion (INDEL) analyses on the genomic DNA from the three groups showed that in the 1‐NIE sample, the most frequent mutations were G → A and C → T. The mutations A → C and T → G were confirmed in the 14‐NIE and 19‐NIE samples. Although the number of SNPs in the N section was small, sequences of 4681 bp (1‐NIE), 4217 bp (14‐NIE) and 4631 bp (19‐NIE) in length were identified. From the INDEL length distribution of the three samples, most changes were associated with insertions and deletions of 1–2 bp. However, no heterogeneity was found in the population samples analyzed based on SNP data. Comparative analysis of the SNPs investigated revealed that 760 819 (11.72%) of the total 6 492 517 SNPs were found in common, demonstrating that the three groups analyzed had different genetic backgrounds. Overall, we have developed a method for analyzing the genetic diversity of L. humile invading the Republic of Korea, precisely classified its genetic characteristics and obtained genomic data on interspecies mutations, according to the local environment.

show abstract

“…NGS raw reads of truffle (SRA accession: SRR5005499) were downloaded from NCBI and processed under the Genome Information System (GeIS, http://geis.infoboss.co.kr) which has been utilized in various genomics studies. 7–9,13,14,17,19,20,25–83 SRR5005499 dataset used in this study contains 29,010,538 100-bp-reads (2,901,053,800 bp). In the pipeline, de novo assembly and confirmation were done by Velvet v1.2.10…”

Section: Methodsmentioning

confidence: 99%

The investigation of intraspecific characteristics and comparative analyses of the complete mitochondrial genome of Stegobium paniceum (Linnaeus, 1758) (Coleoptera: Ptinidae) assembled from public NGS raw reads of the black truffle, Tuber melanosporum

Park¹,

Lee²,

Park³

2022

Science Progress

Self Cite

View full text Add to dashboard Cite

Due to the rapid development of NGS technologies, a huge amount of NGS raw reads have been accumulated in public repositories, such as the Short Read Archive of NCBI. We successfully rescued the complete mitochondrial genome of Stegobium paniceum, a drug store beetle, from public NGS raw reads of truffle generated from the whole genome project. The circular mitogenome of S. paniceum is 15,474 bp long including 13 protein-coding genes, two ribosomal RNA genes, 22 transfer RNAs, and a single large non-coding region of 803 bp. Intraspecific transfer RNAs structure and sequence variations were investigated and simple sequence repeats identified from three S. paniceum mitochondrial genomes were compared showing their diversities as fundamental data to utilize them in various aspects including developing efficient molecular markers in the family, Ptinidae. Phylogenetic analysis of 23 Bostrichoidea mitochondrial genomes presented better species identification based on phylogenetic analyses and the optimal options for constructing phylogenetic trees based on Bostrichoidea mitochondrial genomes. Our results present not only utilization of public NGS raw read sequences but also intraspecific features of S. paniceum mitochondrial genomes and comparative analysis of Bostrichoidea mitochondrial genomes in various aspects.

show abstract

Complete mitochondrial genome of the H3 haplotype Argentine ant Linepithema humile (Mayr, 1868) (Formicidae; Hymenoptera)

Cited by 6 publications

References 21 publications

A New Mitochondrial Genome of Sogatella furcifera (Horváth) (Hemiptera: Delphacidae) and Mitogenome-Wide Investigation on Polymorphisms

A New Mitochondrial Genome of Sogatella furcifera (Horváth) (Hemiptera: Delphacidae) and Mitogenome-Wide Investigation on Polymorphisms

Analysis of whole‐genome changes and characteristics of Linepithema humile (Hymenoptera: Formicidae) in the Republic of Korea

The investigation of intraspecific characteristics and comparative analyses of the complete mitochondrial genome of Stegobium paniceum (Linnaeus, 1758) (Coleoptera: Ptinidae) assembled from public NGS raw reads of the black truffle, Tuber melanosporum

Contact Info

Product

Resources

About