Complete sequence of pSC101

Bernardi, Alberto De; Bernardi, Françoise

doi:10.1093/nar/12.24.9415

Cited by 123 publications

(69 citation statements)

References 31 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The plasmid pUT1705 was used as a source of the pSC101 Mob proteins. This plasmid consists of a pSC101 DNA fragment (bp 2269 to 4069 [6]) that includes the mob genes but lacks oriT. The fragment was cloned between the EcoRV and BamHI sites of pACYC184.…”

Section: Methodsmentioning

confidence: 99%

“…1B. In these plasmids, position 2 contained pSC101 oriT DNA (bp 4070 to 4129 [6]). The oligonucleotide GCC CCAAGCTTATGGATCCGAAGAGAAACGTCTAAGTGCGCCCTCCCT TTTGGCAATTGGGCCC and the same oligonucleotide except with a T at position 27 were amplified with the primers GCCCAAGCTTATGGATC and GGGCCCAATTGGGCCC, and the product was cloned between the BamHI and MfeI sites at position 1, as shown in Fig.…”

Section: Methodsmentioning

confidence: 99%

“…The plasmid pUT1705 was used as a source of the pSC101 Mob proteins. This plasmid consists of a pSC101 DNA fragment (bp 2269 to 4069 [6]) that includes …”

mentioning

confidence: 99%

See 2 more Smart Citations

Stringent and Relaxed Recognition of oriT by Related Systems for Plasmid Mobilization: Implications for Horizontal Gene Transfer

Jandle

Meyer

2006

J Bacteriol

View full text Add to dashboard Cite

The plasmids R1162 and pSC101 have origins of conjugative transfer (oriTs) and corresponding relaxases that are closely related. The oriTs are made up of a highly conserved core, where DNA is cleaved by the relaxase prior to transfer, and an inverted repeat that differs in size and sequence. We show that in each case the seven base pairs adjacent to the core and within one arm of the inverted repeat are sufficient to determine specificity. Within this DNA there are three AT base pairs located 4 bp from the core. Mutations in the AT base pairs suggest that the relaxase makes essential contacts at these locations to the minor groove of the DNA. The remaining four bases are different for each oriT and are both necessary and sufficient for stringent recognition of oriT by the pSC101 mobilization proteins. In contrast, the R1162 mobilization proteins have a much more relaxed requirement for the base sequence of this specificity region. As a result, the R1162 mobilization proteins can initiate transfer from a variety of sites, including those derived from the chromosome. The R1162 mobilization proteins could therefore contribute to the horizontal gene transfer of DNA from diverse sources.The plasmids R1162 and pSC101 have closely related systems for conjugative mobilization, although they are otherwise unrelated. These mobilization (Mob) systems belong to a large family, with examples found in plasmids from both gram-negative and gram-positive bacteria (12). Within this family, the general structures of the origins of conjugative transfer (oriTs) are similar and are characterized by a highly conserved region called the core and an adjacent, inverted repeat that varies in both size and sequence (3). These features are shown for the R1162 and pSC101 oriTs in Fig. 1A. We recently suggested that the oriTs of this family were generated by the duplication and inversion of the core and adjacent DNA on several separate occasions (3). The resulting second copy of the core was then lost by deletion, although remnants have remained in several cases, including the oriT of pSC101. The properties of the relaxases indicated that this duplication and inversion was necessary in the evolution of a system for the efficient transfer of circular DNA. The cognate relaxase binds double-stranded DNA, initiates strand separation within the core, and cleaves one of these strands at the nick site. The cleavage takes place by a transesterification that results in transient covalent linkage of the protein to the 5Ј end of the DNA strand (8,22,23). The relaxase and the attached strand, unwound from its complement, are then transferred into a recipient cell by type IV secretion (11). Duplication and inversion of DNA next to the core generates an inverted repeat, which re-creates the binding site for the attached relaxase. This allows the subsequent reversal of the transesterification to regenerate a circular molecule of DNA. The outer arm of the inverted repeat is not required for relaxase-induced nicking of supercoiled DNA at the beginning of a ro...

show abstract

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Stringent and Relaxed Recognition of oriT by Related Systems for Plasmid Mobilization: Implications for Horizontal Gene Transfer

Jandle

Meyer

2006

J Bacteriol

View full text Add to dashboard Cite

show abstract

“…These mutants were transduced with ⌬(recA-srl)306 srl::Tn10 of strain CSH126 (38) and were used for complementation tests. Plasmids pUC118 (60) and pMW119 (8,62) were the cloning vectors. TLY broth, nutrient agar, nutrient semisolid agar for the motility test, and X-Gal (5-bromo-4-chloro-3-indolyl-␤-D-galactopyranoside) medium were as described previously (14,55).…”

Section: Methodsmentioning

confidence: 99%

Cloning and characterization of the region III flagellar operons of the four Shigella subgroups: genetic defects that cause loss of flagella of Shigella boydii and Shigella sonnei

1997

View full text Add to dashboard Cite

To detect genetic defects that might have caused loss of flagella in Shigella boydii and Shigella sonnei, the region III flagellar (fli) operons were cloned from certain strains and analyzed with reference to the restriction maps and genetic maps of Escherichia coli fli operons. S. boydii NCTC9733 (strain C5 in this paper) had the 988-bp internal deletion in the fliF gene that encodes a large substructural protein of the basal body. Two strains (C1 and C8) had deletions of the entire fliF operon, and the remaining three (C3, C4, and C9) differed in the size of the restriction fragments carrying the fliF and fliL operons. Loss of flagella in S. boydii appears to originate in some defect in the fliF operon. S. sonnei IID969 lacked the fliD gene and, in place of it, carried two IS600 elements as inverted repeats. Genes downstream from fliD were not detected in the cloned fragment despite its large size but did appear elsewhere in the chromosome. The fliD gene encodes a cap protein of the flagellar filament, and its deletion results in overexpression of class 3 operons by the increased amount of FliA ( F ) caused by the excess export of the anti-sigma factor FlgM. Three other strains also had the fliD deletion, and two of them had another deletion in the fliF-fliG-fliH region. The fliD deletion might be the primary cause of loss of flagella in S. sonnei. The lack of FliF or FliD in each subgroup is discussed in connection with the maintenance of virulence and bacterial growth. We also discuss the process of loss of flagella in relation to transposition of IS elements and alterations of the noncoding region, which were found to be common to at least three subgroups.The genus Shigella is divided into four subgroups or species: Shigella dysenteriae, Shigella flexneri, Shigella boydii, and Shigella sonnei (46). All are pathogens which cause diarrhea and dysentery in humans and certain other primates (37). Shigellae have been regarded as nonmotile organisms lacking flagella (15), and this characteristic has been used as one of the taxonomic and diagnostic criteria to distinguish shigellae from other enteric bacteria. However, it has been reported that some prototypical strains of the four subgroups and two fresh clinical isolates of S. sonnei are sparsely flagellate (19). We have not yet detected any motile strain among the four subgroups in the more than 20 laboratory strains we have examined so far; instead we have detected defective flagellar genes in some strains of these subgroups (4, 56). Therefore, we have been studying loss of motility by shigellae from the point of view that almost all shigellae are nonmotile because of a lack of flagellation.Approximately 50 genes, composing at least 13 operons, are involved in the biogenesis and functioning of a flagellum of Escherichia coli and Salmonella typhimurium (33). These operons are clustered into three different regions on the chromosome. Region I operons mainly contain flagellar structural genes designated flg; region II contains a mixture of flagellar (flh) and mot...

show abstract

“…-Among other approaches, we can mention for example the original research of Professor Giorgio Bernardi on "isochores" [7,8].…”

Section: Introductionmentioning

confidence: 99%

The “3 Genomic Numbers” Discovery: How Our Genome Single-Stranded DNA Sequence Is “Self-Designed” as a Numerical Whole

Perez¹

2013

View full text Add to dashboard Cite

This article proves the existence of a hyper-precise global numerical meta-architecture unifying, structuring, binding and controlling the billion triplet codons constituting the sequence of single-stranded DNA of the entire human genome. Beyond the evolution and erratic mutations like transposons within the genome, it's as if the memory of a fossil genome with multiple symmetries persists. This recalls the "intermingling" of information characterizing the fractal universe of chaos theory. The result leads to a balanced and perfect tuning between the masses of the two strands of the huge DNA molecule that constitute our genome. We show here how codon populations forming the single-stranded DNA sequences can constitute a critical approach to the understanding of junk DNA function. Then, we suggest revisiting certain methods published in our 2009 book "Codex Biogenesis". In fact, we demonstrate here how powerful a analytical filter the universal genetic code table is to characterize single-stranded DNA sequences constituting chromosomes and genomes. We can then show that any genomic DNA sequence is featured by three numbers, which characterize it and its 64 codon populations with correlations greater than 99%. The number "1" is common to all sequences, expressing the second law of Chargaff. The other 2 numbers are related to each specific DNA sequence case characterizing life species. For example, the entire human genome is characterized by three remarkable numbers 1, 2, and Phi = 1.618 the golden ratio. Associated with each of these three numbers, we can match three axes of symmetry, then "imagine" a kind of hyperspace formed by these codon populations. Then we revisit the value (3-Phi)/2 which is probably universal and common to both the scale of quarks and atomic levels, balancing and tuning the whole human genome codon population. Finally, we demonstrate a new kind of duality between "form and substance" overlapping the whole human genome: we will show that-simultaneously with the duality between genes and junk DNA-there is a second layer of embedded hidden structure overlapping all the DNA of the whole human genome, dividing it into a second type of duality information/redundancy involving golden ratio proportions.

show abstract

Complete sequence of pSC101

Abstract: We have completed the pSC101 sequence. The coding capacities of the newly sequenced regions show the presence of two large open reading frames close to the oriT region. Their size and localization suggest that these polypeptide chains could be involved in the transfer process of pSC101.

Cited by 123 publications

References 31 publications

Stringent and Relaxed Recognition of oriT by Related Systems for Plasmid Mobilization: Implications for Horizontal Gene Transfer

Stringent and Relaxed Recognition of oriT by Related Systems for Plasmid Mobilization: Implications for Horizontal Gene Transfer

Cloning and characterization of the region III flagellar operons of the four Shigella subgroups: genetic defects that cause loss of flagella of Shigella boydii and Shigella sonnei

The “3 Genomic Numbers” Discovery: How Our Genome Single-Stranded DNA Sequence Is “Self-Designed” as a Numerical Whole

Contact Info

Product

Resources

About