Complex Formation between VEGFR2 and the β2-Adrenoceptor

Abstract

Summary Vascular endothelial growth factor (VEGF) is an important mediator of endothelial cell proliferation and angiogenesis via its receptor VEGFR2. A common tumor associated with elevated VEGFR2 signaling is infantile hemangioma that is caused by a rapid proliferation of vascular endothelial cells. The current first-line treatment for infantile hemangioma is the β-adrenoceptor antagonist, propranolol, although its mechanism of action is not understood. Here we have used bioluminescence resonance energy transfer and VEGFR2 genetically tagged with NanoLuc luciferase to demonstrate that oligomeric complexes involving VEGFR2 and the β 2 -adrenoceptor can be generated in both cell membranes and intracellular endosomes. These complexes are induced by agonist treatment and retain their ability to couple to intracellular signaling proteins. Furthermore, coupling of β 2 -adrenoceptor to β-arrestin2 is prolonged by VEGFR2 activation. These data suggest that protein-protein interactions between VEGFR2, the β 2 -adrenoceptor, and β-arrestin2 may provide insight into their roles in health and disease.

CRISPR-Mediated Protein Tagging with Nanoluciferase to Investigate Native Chemokine Receptor Function and Conformational Changes

“…Guide sequences used to target Cas9 to the genomic loci were; for CXCR4 N-terminus; guide-RNA1, ATCCCCTCCATGGTAACCGC, and guideRNA2, TGGAGAACCAGCGGTTACCA, for ACKR3 N-terminus; guideRNA1, GATTGCCCGCCTCAGAACGA and guideRNA2, GATGCAGATCCATCGTTCTG, to knockout CXCL12 by InDel formation Cas9 was targeted to the N-terminal region using guideRNA1, GGCATGGGCATCTGTAGCTC and guideRNA2, CATCTGTAGCTCAGGCT GAC. The guide RNA sequences used to target the CXCR4 and ARRB2 C-terminus have been described previously (White et al, 2017), as have the guide RNA sequences used to target the N-terminus of ADRB2 (Kilpatrick et al, 2019). To introduce DNA encoding NLuc or NanoBiT fragments donor repair templates (Table S2) were designed using the UCSC genome browser (http://genome.ucsc.edu/), Human genome assembly (GRCh38/hg38).…”

CRISPR/Cas9-mediated generation and analysis of N terminus polymorphic models of β2AR in isogenic hPSC-derived cardiomyocytes

“…While in the heart the β 2 AR offers protection to cardiomyocytes by activating the Gi pathway, 31 in the cancer setting it enhances invasiveness upon stimulation. 68 , 69 Understanding the effect of β 2 AR polymorphisms on cardiac response to anticancer therapy would have immediate clinical impact and will help to choose more accurate therapy prescriptions. Having additional tools to evaluate the balance between these outcomes will be vital to define risk and benefit of drugs such as beta-blockers in precision medicine.…”

Using the novel HiBiT tag to label cell surface relaxin receptors for BRET proximity analysis

“…This is not a new idea – previous successful approaches to investigate GPCR oligomerization have used fluorescent antibodies directed against N‐terminal epitope tags or used specific labeling proteins such as the SNAP tag to perform time resolved FRET experiments. More recently, surface labeled SNAP tag fused receptors were used in combination with Nanoluc‐tagged VEGR2 (a receptor tyrosine kinase) to investigate the possibility of interactions between VEGR2 and the β 2 ‐adrenergic receptor …”