Compound heterozygous POMT1 mutations in a Chinese family with autosomal recessive muscular dystrophy‐dystroglycanopathy C1

Abstract

Muscular dystrophy‐dystroglycanopathy (MDDG) is a genetically and clinically heterogeneous group of muscular disorders, characterized by congenital muscular dystrophy or later‐onset limb‐girdle muscular dystrophy accompanied by brain and ocular abnormalities, resulting from aberrant alpha‐dystroglycan glycosylation. Exome sequencing and Sanger sequencing were performed on a six‐generation consanguineous Han Chinese family, members of which had autosomal recessive MDDG. Compound heterozygous mutations, c.1338+1G>A (p.H415Kfs*3) and c.1457G>C (p.W486S, rs746849558), in the protein O‐mannosyltransferase 1 gene (POMT1), were identified as the genetic cause. Patients that exhibited milder MDDG manifested as later‐onset progressive proximal pelvic, shoulder girdle and limb muscle weakness, joint contractures, mental retardation and elevated creatine kinase, without structural brain or ocular abnormalities, were further genetically diagnosed as MDDGC1. The POMT1 gene splice‐site mutation (c.1338+1G>A) which leads to exon 13 skipping and results in a truncated protein may contribute to a severe phenotype, while the allelic missense mutation (p.W486S) may reduce MDDG severity. These findings may expand phenotype and mutation spectrum of the POMT1 gene. Clinical diagnosis supplemented with molecular screening may result in more accurate diagnoses of, prognoses for, and improved genetic counselling for this disease.

Identification of a GNE homozygous mutation in a Han‐Chinese family with GNE myopathy

“…Filtrations of all identified variations were performed based on following references: mean coverage ≥100, mutation ratio ≥10, absence of mutation in 1000 Genomes Project and non‐synonymous mutations . Direct Sanger sequencing confirmed the potential pathogenic variant via an ABI3500 sequencer (Applied Biosystems, Foster City, CA, USA) . PCR amplification and Sanger sequencing primer sequences are as follows: 5′‐CCTTGTGTTTGTGGTGGAGC‐3′ and 5′‐CCTCTTACCTGTGCCTGTGA‐3′.…”

“…13,14 Direct Sanger sequencing confirmed the potential pathogenic variant via an ABI3500 sequencer (Applied Biosystems, Foster City, CA, USA). [15][16][17] PCR amplification and Sanger sequencing primer sequences are as follows: 5′-CCTTGTGTTTGTGGTGGAGC-3′ and 5′-CCTCTTACCTGT GCCTGTGA-3′.…”

A novel, homozygous nonsense variant of the CDHR1 gene in a Chinese family causes autosomal recessive retinal dystrophy by NGS‐based genetic diagnosis

“…After quality assessment, more than 97% of the billions of bases were aligned to the human reference sequences and, among those, billions of bases were recovered with a 10‐fold coverage target region. Then, causative mutations were identified by automatic variant calling, filtering and annotation pipeline in the capture sequencing data . SIFT, Polyphen 2, LRT, MutationTaster, MutationAssessor and dbNSFP were used to filter out non‐pathogenic population variations, which were not annotated in any of the above public databases and were prioritized for further confirmation and characterization.…”

COL1A2 p.Gly1066Val variant identified in a Han Chinese family with osteogenesis imperfecta type I

“…GenBank NG_007405.1 was adopted as the reference sequence. MutationTaster (http://www.mutationtaster.org/) evaluated the possible impact of amino acid substitution, as previously described (Hu et al, ). Basic Local Alignment Search Tool (BLAST, https://blast.st-va.ncbi.nlm.nih.gov/Blast.cgi) was used for multiple protein sequence alignments.…”