Comprehensive Algorithm for Quantitative Real-Time Polymerase Chain Reaction

Zhao, Sheng; Fernald, Russell D.

doi:10.1089/cmb.2005.12.1047

Cited by 1,153 publications

(883 citation statements)

References 34 publications

Supporting

Mentioning

870

Contrasting

Unclassified

Order By: Relevance

“…Relative mRNA quantification data were then analyzed with the real-time PCR Miner algorithm (Zhao and Fernald, 2005). Primer concentration was previously optimized to the ratio minimum concentration/lowest cycle threshold.…”

Section: Sacrifice and Samplingmentioning

confidence: 99%

Gene expression of regulatory enzymes involved in the intermediate metabolism of sheep subjected to feed restriction

Harten

Brito

Almeida

et al. 2013

Animal

View full text Add to dashboard Cite

The effect of feed restriction on gene expression of regulatory enzymes of intermediary metabolism was studied in two sheep breeds (Australian Merino and Dorper) subjected to two nutritional treatments: feed restriction (85% of daily maintenance requirements) and control (ad libitum feeding), during 42 days. The experimental animals (ram lambs) were divided into four groups, n 5 5 (Australian Merino control (MC), Australian Merino Restriction (MR), Dorper control (DC) and Dorper Restriction (DR)). After the trial, animals were sacrificed and samples were taken from liver tissue to quantify glucose levels and gene expression of relevant intermediary metabolism enzymes (phosphofructokinase (PFK), pyruvate kinase (PK), phosphoenolpyruvate carboxykinase, fructose 1,6-bisphosphatase, glucose-6-phosphatase, glycogen synthase (GS), fatty acid synthase (FAS), glutamate dehydrogenase (GDH) and carbamoyl phosphate synthase (CPS)) through real-time PCR. During the experimental period, the MR animals lost 12.6% in BW compared with 5.3% lost by the Dorper lambs. MC and DC rams gained, respectively, 8.8% and 14% during the same period. Within the Dorper breed, restricted feed animals revealed a significant decrease over controls in the transcription of PFK (1.95-fold) and PK (2.26-fold), both glycolytic enzymes. The gluconeogenesis showed no change in the feed restricted animals of both breeds. DR feed group presented a significant decrease over the homologous Merino sheep group on GS. In both experimental breeds, FAS mRNA expression was decreased in restricted feed groups. GDH expression was decreased only in the DR animals (1.84-fold) indicating a reduced catabolism of amino acids in these animals. Finally, CPS was significantly (P , 0.05) higher in the Dorper sheep, indicating a facilitated urea synthesis in this breed. These results indicate a better adaptation of metabolic intermediate regulatory enzymes and hepatic glucose production of Dorper sheep to feed restriction concurring with the BW results in the experimental groups. ImplicationsThe relevant negative impact in livestock production due to seasonal dry periods within tropical and arid climate regions highlights the need to understand genetic and metabolic adaptation mechanisms to periodical feed restriction. Our results concerning changes in BW and genomic expressions of intermediary metabolism regulatory enzymes of ram lambs of Dorper and Australian Merino breeds subjected to ad libitum and to 85% maintenance energy requirements show that Dorper have a better adaptation to feed restriction than the Merino sheep. Our findings can contribute to future research guidelines leading to improved genetic selection toward livestock adaptation to harsh environments.

show abstract

Section: Sacrifice and Samplingmentioning

confidence: 99%

Gene expression of regulatory enzymes involved in the intermediate metabolism of sheep subjected to feed restriction

Harten

Brito

Almeida

et al. 2013

Animal

View full text Add to dashboard Cite

show abstract

“…Cyclophilin was used as an endogenous reference. Gene expression was analyzed using the Real-time PCR miner algorithm (Zhao and Fernald 2005). The following primers were used: Cyclophilin (Forward: CAGTGCTCAGAGCTCGAAAGT; Reverse: GTGTTCTTCGACATCACGGC), Oat1 (Forward:…”

Section: Rna Extraction Rt-pcr and Quantitative Pcrmentioning

confidence: 99%

Permeation of Fluorophore-Conjugated Phalloidin into Live Hair Cells of the Inner Ear Is Modulated by P2Y Receptors

Thiede

Corwin

2013

JARO

View full text Add to dashboard Cite

Phalloidin, a toxin isolated from the death cap mushroom, Amanita phalloides, binds to filamentous actin with high affinity, and this has made fluorophore-conjugated phalloidin a useful tool in cellular imaging. Hepatocytes take up phalloidin via the liver-specific organic anion transporting polypeptide 1b2, but phalloidin does not permeate most living cells. Rapid entry of styryl dyes into live hair cells has been used to evaluate function, but the usefulness of those fluorescence dyes is limited by broad and fixed absorption spectra. Since phalloidin can be conjugated to fluorophores with various spectra, we investigated whether it would permeate living hair cells. When we incubated mouse utricles in 66 nM phalloidin-CF488A and followed that by washes in phalloidin-free medium, we observed that it entered a subset of hair cells and labeled entire hair bundles fluorescently after 20 min. Incubations of 90 min labeled nearly all the hair bundles. When phalloidin-treated utricles were cultured for 24 h after washout, the label disappeared from the hair cells and progressively but heterogeneously labeled filamentous actin in the supporting cells. We investigated how phalloidin may enter hair cells and found that P2 receptor antagonists, pyridoxalphosphate-6-azophenyl-2′, 4′-disulfonic acid and suramin, blocked phalloidin entry, while the P2Y receptor ligands, uridine-5'-diphosphate and uridine-5'-triphosphaste, stimulated uptake. Consistent with that, the P2Y6 receptor antagonist, MRS 2578, decreased phalloidin uptake. The results show that phalloidin permeates live hair cells through a pathway that requires metabotropic P2Y receptor signaling and suggest that phalloidin can be transferred from hair cells to supporting cells in culture.

show abstract

“…The Real-time PCR Miner online tool (20) was used to calculate PCR efficiency and the optimal threshold cycle (C T) for each well. The mean relative expression ratio (rER) and standard deviation for the mdm gene were calculated using 18S rRNA as the endogenous control gene, and the digestive gland cDNA of the control acclimated animals was used as the reference sample (21).…”

Section: Expression Analysismentioning

confidence: 99%

Correlation between the Expression Level of the MDM Homolog Gene and Inflammatory Lesions in Different Populations of the Model Organism Mytilus Galloprovincialis from Polluted Areas of the Gulf of Naples (Southern Italy)

et al. 2013

View full text Add to dashboard Cite

The first two authors contributed equally to this workIn vertebrate species, the MDM2 and MDM4 gene paralogs negatively regulate the activity of p53 family members and are involved in the development of a number of tumor types. Comparative genomic analyses have shown the presence of a single mdm homolog gene in invertebrates; its interaction with p53 and its involvement in tumor pathogenesis was demonstrated only in the mussel Mytilus trossulus. In addition to p53-related activity, a pro-inflammatory role for MDM2 in mammals has recently been described. In the present paper, we report the Real-time RT-PCR expression analysis of the mdm homolog gene in digestive gland tissue of Mytilus galloprovincialis collected from four different sites in the Campania region (Italy) during a single year. Our results revealed a positive correlation between the expression level of the mdm homolog and the percentage of chronic inflammatory lesions, both of which are increased during the summer period, suggesting a previously unidentified involvement of mdm in inflammatory processes in invertebrate species. Results obtained pointed out the potential interest of the use of mdm gene expression in marine food and seawater quality evaluation monitoring programs.

show abstract

Comprehensive Algorithm for Quantitative Real-Time Polymerase Chain Reaction

Cited by 1,153 publications

References 34 publications

Gene expression of regulatory enzymes involved in the intermediate metabolism of sheep subjected to feed restriction

Gene expression of regulatory enzymes involved in the intermediate metabolism of sheep subjected to feed restriction

Permeation of Fluorophore-Conjugated Phalloidin into Live Hair Cells of the Inner Ear Is Modulated by P2Y Receptors

Correlation between the Expression Level of the MDM Homolog Gene and Inflammatory Lesions in Different Populations of the Model Organism Mytilus Galloprovincialis from Polluted Areas of the Gulf of Naples (Southern Italy)

Contact Info

Product

Resources

About