Comprehensive Analysis of Varicella-Zoster Virus Proteins Using a New Monoclonal Antibody Collection

Self Cite

Varicella-zoster virus (VZV) causes chickenpox upon primary infection and establishes latency in ganglia.Reactivation from latency causes herpes zoster, which may be complicated by postherpetic neuralgia. Innate immunity mediated by interferon and proinflammatory cytokines represents the first line of immune defense upon infection and reactivation. VZV is known to interfere with multiple innate immune signaling pathways, including the central transcription factor NF-B. However, the role of these inhibitory mechanisms in vivo is unknown. Simian varicella virus (SVV) infection of rhesus macaques recapitulates key aspects of VZV pathogenesis, and this model thus permits examination of the role of immune evasion mechanisms in vivo. Here, we compare SVV and VZV with respect to interference with NF-B activation. We demonstrate that both viruses prevent ubiquitination of the NF-B inhibitor IB␣, whereas SVV additionally prevents IB␣ phosphorylation. We show that the ORF61 proteins of VZV and SVV are sufficient to prevent IB␣ ubiquitination upon ectopic expression. We further demonstrate that SVV ORF61 interacts with ␤-TrCP, a subunit of the SCF ubiquitin ligase complex that mediates the degradation of IB␣. This interaction seems to inactivate SCF-mediated protein degradation in general, since the unrelated ␤-TrCP target Snail is also stabilized by ORF61. In addition to ORF61, SVV seems to encode additional inhibitors of the NF-B pathway, since SVV with ORF61 deleted still prevented IB␣ phosphorylation and degradation. Taken together, our data demonstrate that SVV interferes with tumor necrosis factor alpha (TNF-␣)-induced NF-B activation at multiple levels, which is consistent with the importance of these countermechanisms for varicella virus infection. IMPORTANCEThe role of innate immunity during the establishment of primary infection, latency, and reactivation by varicella-zoster virus (VZV) is incompletely understood. Since infection of rhesus macaques by simian varicella virus (SVV) is used as an animal model of VZV infection, we characterized the molecular mechanism by which SVV interferes with innate immune activation. Specifically, we studied how SVV prevents activation of the transcription factor NF-B, a central factor in eliciting proinflammatory responses. The identification of molecular mechanisms that counteract innate immunity might ultimately lead to better vaccines and treatments for VZV, since overcoming these mechanisms, either by small-molecule inhibition or by genetic modification of vaccine strains, is expected to reduce the pathogenic potential of VZV. Moreover, using SVV infection of rhesus macaques, it will be possible to study how increasing the vulnerability of varicella viruses to innate immunity will impact viral pathogenesis. V aricella-zoster virus (VZV) is a member of the subfamily Alphaherpesvirinae and is the causative agent of chickenpox and herpes zoster (HZ). Following primary infection, VZV establishes latency in ganglia. Reactivation from latency, which typically occurs late...

Section: Methodsmentioning

confidence: 99%

The ORF61 Protein Encoded by Simian Varicella Virus and Varicella-Zoster Virus Inhibits NF-κB Signaling by Interfering with IκBα Degradation

Whitmer

Malouli

Uebelhoer

et al. 2015

Self Cite

“…We thank H. Zhu for BAC-VZV-pOka-WT (17), the Biology Research Branch at the NCI for the pGalK plasmid and SW102 bacterial strain, M. Sommer for gB and ORF66 antisera (18,19), and S. Jonjic for anti-gH, ORF24, and ORF27 antibodies (20). We also thank P. Piscicelli for TEM preparations and the GIGA Imaging and GIGA Genotranscriptomics platforms for their technical support.…”

Section: Acknowledgmentsmentioning

confidence: 99%

Deletion of the ORF9p Acidic Cluster Impairs the Nuclear Egress of Varicella-Zoster Virus Capsids

Riva

Thiry

Lebrun

et al. 2015

The protein encoded by ORF9 is essential for varicella-zoster virus (VZV) replication. Previous studies documented its presence in the trans-Golgi network and its involvement in secondary envelopment. In this work, we deleted the ORF9p acidic cluster, destroying its interaction with ORF47p, and this resulted in a nuclear accumulation of both proteins. This phenotype results in an accumulation of primary enveloped capsids in the perinuclear space, reflecting a capsid de-envelopment defect.O ne of the crucial steps in herpesviruses infection is capsid exit from the nucleus. This process mainly follows the envelopment/de-envelopment model, strongly documented by transmission electron microscopy (TEM) observations (1). According to this model, nuclear capsids bud at the inner nuclear membrane (INM), thereby acquiring a primary envelope, which is then lost after fusion with the outer nuclear membrane (ONM), resulting in the release of naked capsids into the cytoplasm (1).Viral glycoproteins seem to play a role during this de-envelopment fusion process (2). In the case of herpes simplex virus (HSV), it is known that gB and gH/gL, components of the viral entry machinery, are present at nuclear membranes and are likely responsible for this fusion (2, 3). Moreover, the fusogenic role of gB seems to be mediated by its pUS3-dependent phosphorylation (4). These hypotheses are supported by observations that HSV mutants lacking pUS3 or both gB and gH accumulate primary enveloped virions in the perinuclear space (3, 4). The components of the nuclear export complex (NEC), pUL31 and pUL34, have been described to mediate the primary envelopment (2). Phosphorylation of pUL31, another substrate of pUS3, also promotes the de-envelopment process (5).Unfortunately, the mechanisms leading to varicella-zoster virus (VZV) nuclear egress are still poorly understood, and it is not clear whether the role of these proteins is conserved in VZV egress. In this work, we destroyed the interaction of the essential VZV tegument protein ORF9p (6) with the viral kinase ORF47p, homologous to HSV-1 VP22 and UL13, respectively, and this affected their localization and impaired VZV de-envelopment.ORF9 is the most transcribed VZV gene during infection (7), and ORF9p has been observed to be present in the trans-Golgi network (TGN) (8), playing a role in secondary envelopment (9). Within its sequence is an acidic motif corresponding to residues 85 to 93: EDDFEDIDE (Fig. 1B). Acidic clusters are described as targeting signals to the TGN (10), and the HSV VP22 acidic cluster has been shown to have a role in both correct protein subcellular localization and virion incorporation (11). We thus deleted this acidic region to generate BAC-VZV-ORF9-⌬AC-V5 C-ter ( Fig. 1A and B). Transfection of this bacterial artificial chromosome (BAC) into MeWo cells led to VZV-ORF9-⌬AC-V5 virus. Infection analysis revealed a significant defect in infectivity for this mutant, compared to that of the previously described VZV-ORF9-V5 (Fig. 1C) (9). Generation of the revertant VZV-...

“…To date, only a single form of VZV ORF48 has been localized to the nucleus of VZV-infected MeWo cells in culture (24). In contrast, HSV-1 encodes two forms of the nuclease, a longer form also localized to the nucleus (UL12) and a shorter form found in mitochondria and active on mitochondrial DNA (UL12.5) (25)(26)(27)(28).…”

mentioning

confidence: 99%

Varicella-Zoster Virus Open Reading Frame 48 Encodes an Active Nuclease

Mueller¹,

Gilden

Cohrs

2013

Based on a DNA sequence and relative genomic position similar to those other herpesviruses, varicella-zoster virus (VZV) open reading frame 48 (ORF48) is predicted to encode an alkaline nuclease. Here we report the cloning, expression, purification, and characterization of recombinant VZV ORF48 protein and a VZV ORF48 point mutation (T172P). Protein encoded by wild-type ORF48, but not mutant protein, displayed both endo-and exonuclease activity, identifying ORF48 as a potential therapeutic target in VZV disease since efficient viral replication requires viral nuclease activity. V aricella-zoster virus (VZV) is an alphaherpesvirus. Primary infection causes childhood varicella (chickenpox), during which time virus becomes latent in ganglionic neurons along the entire neuraxis (1, 2). VZV reactivation typically results in zoster (shingles), which can be complicated by postherpetic neuralgia, VZV myelopathy, stroke (3-8), and retinal necrosis. Inhibition of virus DNA replication is the current means to treat VZV infections resulting from primary contact or virus reactivation. While drug resistance is rare, an increase in VZV infections among immunocompromised individuals warrants development of additional anti-VZV therapies (9, 10). An appealing target for new therapeutics is the virus nuclease predicted by sequence homology to herpes simplex virus 1 (HSV-1) to be encoded by VZV open reading frame 48 (ORF48) (11,12).VZV contains 70 annotated ORFs, 31 with assigned function, 8 of which are essential for VZV growth in tissue culture cells (13). VZV ORF48 encodes a 551-amino-acid protein, 75 residues shorter than the HSV-1 alkaline nuclease encoded by UL12; ORF48 and UL12 share 36% amino acid identity (Fig. 1). To obtain sufficient VZV ORF48 protein for functional analysis, the protein-encoding region was PCR amplified from VZV DNA using 5=-TTTCCATGGCACG ATCGGGATTG (forward primer; IDT, Coralville, IA) and 5=-GA AGTCGACAAGCAACGGTTTCTC (reverse primer) inserted into pBAD myc/his-A prokaryotic expression vector (Life Technologies, Carlsbad, CA) at unique NcoI and SalI restriction endonuclease sites to construct a VZV ORF48-myc/hys-A fusion protein ( Fig. 2A) for expression in Escherichia coli along with VZV ORF48 T172P , a VZV ORF48 mutation encoding a tyrosine-to-proline mutation at amino acid 172. PCR conditions, protein expression, including arabinose induction, and protein purification by affinity column chromatography using cobalt-charged immobilized metal affinity chromatography (IMAC) resin (Bio-Rad, Hercules, CA) were as previously described (14). VZV ORF48 and ORF48 T172P were stored in 50 mM Tris-HCl (pH 8)-20% glycerol-0.2% Triton X-100 -1 mM dithiothreitol (DTT). SDS-PAGE analysis of VZV ORF48 indicated ϳ95% purity of the ϳ65-kDa protein identified by total protein staining with Coomassie brilliant blue R (Fig. 2B). Probing the Western blot with antibody specific for the histidine tag (Life Technologies) confirmed the identity of the ϳ65-kDa protein as the ORF48/his fusion protein (Fig. 2C).While VZV ORF48 fu...