Comprehensive characterization of <i><scp>RSPO</scp></i> fusions in colorectal traditional serrated adenomas

Sekine, Shigeki; Ogawa, Reiko; Hashimoto, Taiki; Kojima, Masayasu; Yoshida, Hiroshi; Taniguchi, Hirokazu; Saito, Yutaka; Ohno, Yasuhiro; Ochiai, Atsushi; Hiraoka, Nobuyoshi

doi:10.1111/his.13265

Cited by 37 publications

(38 citation statements)

References 22 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The present study identified RSPO fusions in 33 of 99 TSAs (33%), 29 of which had previously reported PTPRK – RSPO3 fusions. This is in agreement with previous studies demonstrating that PTPRK – RSPO3 is the predominant RSPO fusion in TSAs . In addition, we identified EIF3E – RSPO2 and PIEZO1 – RSPO2 fusions in three and one TSAs, respectively.…”

Section: Discussionsupporting

confidence: 93%

“…Similarly to other serrated lesions, most TSAs harbour either KRAS or BRAF mutations, which lead to activation of the mitogen‐activated protein kinase pathway . In addition, our previous studies have shown that most TSAs also have genetic alterations in genes encoding WNT pathway components, including RNF43 , APC and CTNNB1 mutations, and RSPO fusions . These genetic alterations are found in a mutually exclusive manner, supporting their roles in the activation of the WNT pathway in TSAs.…”

Section: Introductionmentioning

confidence: 77%

“…The remaining four lesions expressed marginal or undetectable levels of the exon 1–2 region. The unbalanced overexpression of exon 3–4 suggests the presence of RSPO2 fusion transcripts in these lesions . RT‐PCR for known RSPO2 fusions identified EIF3E – RSPO2 in three lesions, but none of them had NRIP1 – RSPO2 (Figure C).…”

Section: Resultsmentioning

confidence: 98%

“…The reverse transcription reaction was performed with the High‐capacity cDNA Reverse Transcription Kit (ThermoFisher Scientific, Waltham, MA, USA). The polymerase chain reaction (PCR) conditions for PTPRK – RSPO3 , EIF3E – RSPO2 and NRIP1 – RSPO2 have been described previously . RSPO2 and RSPO3 expression levels were determined with quantitative RT‐PCR …”

Section: Methodsmentioning

confidence: 99%

“…5′‐RACE was performed by use of the SMARTer RACE cDNA Amplification Kit (Clontech Laboratories, Mountain View, CA, USA) with a gene‐specific primer (5′‐CGGCTACACCCATTGTCCTTTGAACAAGAC‐3′) . The PCR product was cloned by use of the TOPO TA Cloning Kit (ThermoFisher Scientific) and sequenced.…”

Section: Methodsmentioning

confidence: 99%

See 4 more Smart Citations

EIF3E–RSPO2 and PIEZO1–RSPO2 fusions in colorectal traditional serrated adenoma

Hashimoto

Ogawa²,

Yoshida

et al. 2019

Histopathology

Self Cite

View full text Add to dashboard Cite

Aims Traditional serrated adenoma (TSA) is an uncommon type of colorectal serrated polyp. RSPO fusions, which potentiate WNT signalling, are common and characteristic genetic alterations in TSA. The aim of this study was to further characterise the prevalence and variation of RSPO fusions in TSA. Methods and results Quantitative polymerase chain reaction (PCR) analysis of 99 TSAs revealed overexpression of RSPO2 and RSPO3 in six and 29 lesions, respectively. Reverse transcription PCR identified previously reported PTPRK–RSPO3 fusion transcripts in all 29 TSAs with RSPO3 overexpression, confirming that PTPRK–RSPO3 is the predominant RSPO fusion in TSAs. Among the six lesions with RSPO2 overexpression, two overexpressed full‐length RSPO2. An EIF3E–RSPO2 fusion, which is a known recurrent RSPO fusion in colorectal cancer, was detected in three lesions. In addition, rapid amplification of cDNA ends identified a novel PIEZO1–RSPO2 fusion in one TSA. All of the four TSAs with RSPO2 fusions concurrently had KRAS mutations and showed the classic histological features. Conclusions The present study identified EIF3E–RSPO2 and PIEZO1–RSPO2 in TSAs. Our observations expand the spectrum of RSPO fusions in TSAs, and suggest that TSAs are precursors of colorectal cancers with these RSPO2 fusions.

show abstract

Section: Discussionsupporting

confidence: 93%

Section: Introductionmentioning

confidence: 77%

Section: Resultsmentioning

confidence: 98%

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

See 3 more Smart Citations

EIF3E–RSPO2 and PIEZO1–RSPO2 fusions in colorectal traditional serrated adenoma

Hashimoto

Ogawa²,

Yoshida

et al. 2019

Histopathology

Self Cite

View full text Add to dashboard Cite

show abstract

Polyps, polyposis syndromes and tumour‐like lesions of the large intestine

Rosty,

Bettington,

Clouston

2024

Morson and Dawson's Gastrointestinal Pathology

View full text Add to dashboard Cite

R‐spondin‐3 is an oncogenic driver of poorly differentiated invasive breast cancer

Steege

Boer

Timmer

et al. 2022

The Journal of Pathology

View full text Add to dashboard Cite

R‐spondins (RSPOs) are influential signaling molecules that promote the Wnt/β‐catenin pathway and self‐renewal of stem cells. Currently, RSPOs are emerging as clinically relevant oncogenes, being linked to cancer development in multiple organs. Although this has instigated the rapid development and testing of therapeutic antibodies targeting RSPOs, functional evidence that RSPO causally drives cancer has focused primarily on the intestinal tract. Here, we assess the oncogenic capacity of RSPO in breast cancer in a direct fashion by generating and characterizing a novel mouse model with conditional Rspo3 expression in the mammary gland. We also address the prevalence of RSPO gene alterations in breast cancer patients. We found that a quarter of breast cancer patients harbor RSPO2/RSPO3 copy number amplifications, which are associated with lack of steroid hormone receptor expression and reduced patient survival. Foremost, we demonstrate the causal oncogenic capacity of RSPO3 in the breast, as conditional Rspo3 overexpression consistently drives the development of mammary adenocarcinomas in our novel Rspo3 breast cancer model. RSPO3‐driven mammary tumors typically show poor differentiation, areas of epithelial‐to‐mesenchymal transition, and metastatic potential. Given the reported interplay in the Wnt/β‐catenin pathway, we comparatively analyzed RSPO3‐driven mouse mammary tumors versus classical WNT1‐driven analogues. This revealed that RSPO3‐driven tumors are distinct, as the poorly differentiated tumor morphology and metastatic potential were observed in RSPO3‐driven tumorigenesis exclusively, further substantiated by differentiating gene expression profiles. Co‐expression of Rspo3 and Wnt1 transduced mammary tumors with a mixed phenotype harboring morphological features characteristic of both transgenes. In summary, we report that a quarter of breast cancer patients harbor RSPO2/RSPO3 copy number gains, and these patients have a worse prognosis, whilst providing in vivo evidence that RSPO3 drives poorly differentiated invasive breast cancer in mice. Herewith, we establish RSPO3 as a driver of breast cancer with clinical relevance, proposing RSPO3 as a novel candidate target for therapy in breast cancer. © 2022 The Authors. The Journal of Pathology published by John Wiley & Sons Ltd on behalf of The Pathological Society of Great Britain and Ireland.

show abstract

Comprehensive characterization of RSPO fusions in colorectal traditional serrated adenomas

Abstract: The present study identified RSPO fusion transcripts, including three novel transcripts, in one-third of colorectal TSAs and showed that PTPRK-RSPO3 fusions were the predominant cause of RSPO overexpression in colorectal TSA.

Cited by 37 publications

References 22 publications

EIF3E–RSPO2 and PIEZO1–RSPO2 fusions in colorectal traditional serrated adenoma

EIF3E–RSPO2 and PIEZO1–RSPO2 fusions in colorectal traditional serrated adenoma

Polyps, polyposis syndromes and tumour‐like lesions of the large intestine

R‐spondin‐3 is an oncogenic driver of poorly differentiated invasive breast cancer

Contact Info

Product

Resources

About