Conditional Cytomegalovirus Replication In Vitro and In Vivo

Abstract

We have established a conditional gene expression system for cytomegalovirus which allows regulation of genes independently from the viral replication program. Due to the combination of all elements required for regulated expression in the same viral genome, conditional viruses can be studied in different cell lines in vitro and in the natural host in vivo. The combination of a self-sufficient tetracycline-regulated expression cassette and Flp recombinase-mediated insertion into the viral genome allowed fast construction of recombinant murine cytomegaloviruses carrying different conditional genes. The regulation of two reporter genes, the essential viral M50 gene and a dominant-negative mutant gene (m48.2) encoding the small capsid protein, was analyzed in more detail. In vitro, viral growth was regulated by the conditional expression of M50 by 3 orders of magnitude and up to a millionfold when the dominant-negative small capsid protein mutant was used. In vivo, viral growth of the dominant-negative mutant was reduced to detection limits in response to the presence of doxycycline in the organs of mice. We believe that this conditional expression system is applicable to genetic studies of large DNA viruses in general.

Random Screening for Dominant-Negative Mutants of the Cytomegalovirus Nuclear Egress Protein M50

“…The conditional expression of the inhibitory mutants in the context of the wt genome allowed the analysis of their inhibitory phenotype. Thus, the usage of regulation cassettes for conditional expression (27) adds to the work load but provides access to quantification, to the analysis of cell toxicity, and to the improvement of DN function.…”

“…For the generation of a suitable insertion vector for conditional expression of the inhibitory mutants, the enhanced GFP ORF was deleted from vector pO6-IET-gfp (27) with PmeI/ApaI. The synthetic oligonucleotides IET-linker1 (CGCCCCGGGGGCGCGCCGTTAAC ACGCGTGGGCCCGCG) and IET-linker2 (CGCGGGCCCACGCGTGTTA ACGGCGCGCCCCCGGGGCG) were annealed, cut with SmaI and ApaI, and then inserted into the vector, giving rise to pO6-IET-linker.…”

“…Constitutive viral expression of TetR blocks the transcription of the regulated gene. Induction by Dox exposes the viral replication program to the effect of the mutant protein (27). We now inserted each mutant of M50, which had interfered with virus reconstitution, into this regulation cassette.…”

“…However, the inhibitory activity of HA-M50HA-⌬VR remained significant. For tet-regulated systems a cell-line-specific degree of regulation and protein expression was reported elsewhere (17,27).…”

“…7A). Then, the wt and the mutant UL50 coding sequences were transferred into the regulation cassette (27). This regulation cassette had already been used to insert genes into HCMV BAC AD169-FRT carrying an FRT site at the UL45 locus (1).…”