Conserved features of eukaryotic hsp70 genes revealed by comparison with the nucleotide sequence of human hsp70.

Abstract

We have determined the nucleotide sequence of the human hsp7O gene and 5' flanking region. The hsp7O gene is transcribed as an uninterrupted primary transcript of 2440 nucleotides composed of a 5' noncoding leader sequence of 212 nucleotides, a 3' noncoding region of 242 nucleotides, and a continuous open reading frame of 1986 nucleotides that encodes a protein with predicted molecular mass of 69,800 daltons. Upstream of the 5' terminus are the canonical TATAAA box, the sequence ATTGG that corresponds in the inverted orientation to the CCAAT motif, and the dyad sequence CTGGAAT/ATTCCCG that shares homology in 12 of 14 positions with the consensus transcription regulatory sequence common to Drosophila heat shock genes. Comparison of the predicted amino acid sequences of human hsp70 with the published sequences of Drosophila hsp70 and Escherichia coli dnaK reveals that human hsp70 is 73% identical to Drosophila hsp70 and 47% identical to E. coli dnaK. Surprisingly, the nucleotide sequences of the human and Drosophila genes are 72% identical and human and E. coli genes are 50% identical, which is more highly conserved than necessary given the degeneracy of the genetic code. The lack of accumulated silent nucleotide substitutions leads us to propose that there may be additional information in the nucleotide sequence of the hsp7O gene or the corresponding mRNA that precludes the maximum divergence allowed in the silent codon positions.The hsp7O gene in eukaryotic cells is a member of a small family of heat shock or stress-induced genes whose expression is regulated at the transcriptional and translational levels by diverse chemical and biological stresses, including inhibitors of energy metabolism, amino acid analogues, heavy metals, anoxia, and heat shock (1, 2). It has been shown recently that the expression of hsp70 is induced by the viral oncogenes of the DNA tumor viruses adenovirus 5, simian virus 40 (SV40), and polyoma and by the mouse rearranged c-myc oncogene (3-5). These oncogenes share at least two interesting features in that their products are subcellularly localized in the nucleus and are implicated in the immortalization of primary cells in culture (6)(7)(8)(9)(10)(11).Although the function of hsp70 is unknown, we can speculate on its role based on the extensive homology between Drosophila hsp70 and the Escherichia coli heat shock protein dnaK. The amino acid sequence of E. coli dnaK derived from its recently determined nucleotide sequence reveals that it is 48% homologous to Drosophila

‘Survival gene’ Bcl-xl potentiates DNA-raised antitumor immunity

“…The human hsp70 53 was cloned into pcDNA3.1(+)-TRP2-ns vector at the unique sites of BamHI and NotI (TRP2hsp70) using standard PCR clone strategy and primers: 5 0 CGGGATC CATGGCCAAAGCCGCGGCAGTC and 5 0 ATAAGAAT GCGGCCGCCTAATCTACCTCCTCAATGGT (P2). TRP2 was generated by cloning truncated mouse TRP2 including stop codon into pcDNA 3.1(+) vector at the unique sites of NheI and BamHI using primers: P1 and 5 0 CGGG ATCCCTATGAGAGAGTTGTGGACCAAACTGG.…”

Loss of nonclassical MHC molecules MIC-A/B expression during progression of uveal melanoma

“…The MIC gene transcriptional regulatory sequences contain heat-shock elements similar to those in the human Hsp70 promoter. Since genotoxic chemotherapeutic agents such as alkylating, cytotoxic, antimitotic and antimetabolic substances, activate the Hsp70 promoter (Hunt and Morimoto, 1985;Groh et al, 1996) via binding of HSF-1, thereby inducing gene transcription, similar mechanisms, may explain the induction of MIC-A/B expression by fotemustine (Liu et al, 1996). Though induction of MIC-A/B by chemotherapy and subsequent presence of an NKG2D þ inflammatory infiltrate was only investigated in one patient, our previous studies in cutaneous melanoma demonstrated changes in the inflammatory infiltrates at different tumour stages, which were associated with changes in MIC-A/B expression (Vetter et al, 2002), thus strengthening the relevance of these findings in this one patient.…”

Regional Expression of Heat Shock Protein-70 mRNA and c-Fos mRNA following Focal Ischemia in Rat Brain

“…HSP-70 mRNA was detected using a 30-mer oligonucle otide probe with the sequence 3'-GG TAC CAC GAC TGG TTC TAC TTC CTC TAG C-5' (Nowak et aI., 1990b). This sequence, which is reported to be specific for the inducible form of HSP-70 mRNA (Miller et aI., 1987(Miller et aI., ,1991, corresponds to a highly conserved region of the HSP-70 coding sequence, amino acids 122-129 of hu man HSP-70 (Hunt and Morimoto, 1985). As a control for the HSP-70 probe, a 30-mer oligonucleotide with the com plementary sequence was also tested.…”