Conserved redox‐dependent <scp>DNA</scp> binding of <scp>ROXY</scp> glutaredoxins with <scp>TGA</scp> transcription factors

Gutsche, Nora; Holtmannspötter, Michael; Maß, Lucia; O'Donoghue, Martin-Timothy; Büsch, Andrea; Lauri, Antonella; Schubert, Veit; Zachgo, Sabine

doi:10.1002/pld3.30

Cited by 34 publications

(51 citation statements)

References 73 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…The binary pMpGWB-mCherry vector was used for establishing a transformation protocol. This pGWB2 derivate vector comprises the hpt gene mediating hygromycin resistance and the mCherry CDS, which was used as reporter fluorophore expressed under the control of the M. polymorpha Mp EF1α promoter [ 31 , 32 ]. At first, a method based on M. polymorpha transformation protocols [ 18 ] was tested using chopped R. fluitans 001TC LF thallus pieces, which failed to produce lines surviving the hygromycin selection.…”

Section: Resultsmentioning

confidence: 99%

“…Transformation experiments were carried out with the pGWB2 vector derivate pMpGWB-mCherry comprising the hpt hygromycin resistance gene and mediating mCherry expression [ 31 ] under the control of the M. polymorpha EF1α promoter, known to confer a strong and almost ubiquitous expression in Marchantia [ 32 ]. Co-cultivation with Agrobacterium tumefaciens strain C58C1 (pGV2260) carrying the pMpGWB-mCherry plasmid was performed as described by Ishizaki et al [ 18 ] with slight modifications according to Althoff et al [ 32 ].…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Transformation of Riccia fluitans, an Amphibious Liverwort Dynamically Responding to Environmental Changes

Althoff

Zachgo

2020

IJMS

Self Cite

View full text Add to dashboard Cite

The colonization of land by streptophyte algae, ancestors of embryophyte plants, was a fundamental event in the history of life on earth. Bryophytes are early diversifying land plants that mark the transition from freshwater to terrestrial ecosystems. The amphibious liverwort Riccia fluitans can thrive in aquatic and terrestrial environments and thus represents an ideal organism to investigate this major transition. Therefore, we aimed to establish a transformation protocol for R. fluitans to make it amenable for genetic analyses. An Agrobacterium transformation procedure using R. fluitans callus tissue allows to generate stably transformed plants within 10 weeks. Furthermore, for comprehensive studies spanning all life stages, we demonstrate that the switch from vegetative to reproductive development can be induced by both flooding and poor nutrient availability. Interestingly, a single R. fluitans plant can consecutively adapt to different growth environments and forms distinctive and reversible features of the thallus, photosynthetically active tissue that is thus functionally similar to leaves of vascular plants. The morphological plasticity affecting vegetative growth, air pore formation, and rhizoid development realized by one genotype in response to two different environments makes R. fluitans ideal to study the adaptive molecular mechanisms enabling the colonialization of land by aquatic plants.

show abstract

Section: Resultsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Transformation of Riccia fluitans, an Amphibious Liverwort Dynamically Responding to Environmental Changes

Althoff

Zachgo

2020

IJMS

Self Cite

View full text Add to dashboard Cite

show abstract

“…Protein generation and redox electrophoretic mobility shift assay (EMSA) studies were carried out according to Gutsche et al . (). Probes containing two repeats of site IIb (ACTCCATGGTCCCACCCATGGTCCCAC) and site IIa binding motifs (GGTGGGCCCGTAGGTGGGCCCGTA), similar to Kosugi & Ohashi (), and their mutagenized versions, site ΔIIb (ACTCCATGGTCGAACCCATGGTCGAAC) and site ΔIIa (GGTGGGCGAGTAGGTGGGCGAGTA), were analyzed (binding motifs underlined).…”

Section: Methodsmentioning

confidence: 97%

MpTCP1 controls cell proliferation and redox processes in Marchantia polymorpha

et al. 2019

Self Cite

View full text Add to dashboard Cite

TCP transcription factors are key regulators of angiosperm cell proliferation processes. It is unknown whether their regulatory growth capacities are conserved across land plants, which we examined in liverworts, one of the earliest diverging land plant lineages.We generated knockout mutants for MpTCP1, the single TCP-P clade gene in Marchantia polymorpha, and characterized its function by conducting cell proliferation and morphological analyses as well as messenger RNA expression, transcriptome, chemical, and DNA binding studies.Mptcp1 ge lines show a reduced vegetative thallus growth and extra tissue formation in female reproductive structures. Additionally, mutant plants reveal increased hydrogen peroxide (H 2 O 2 ) levels and an enhanced pigmentation in the thallus caused by formation of secondary metabolites, such as aminochromes. MpTCP1 proteins interact redox dependently with DNA and regulate the expression of a comprehensive redox network, comprising enzymes involved in H 2 O 2 metabolism.MpTCP1 regulates Marchantia growth in a context-dependent manner. Redox sensitivity of the DNA binding capacity of MpTCP1 proteins provides a mechanism to respond to altered redox conditions. Our data suggest that MpTCP1 activity could thereby have contributed to diversification of land plant morphologies and to adaptations to abiotic and biotic challenges, as experienced by liverworts during early land plant colonization.

show abstract

“…TGA family proteins are predominantly involved in systemic acquired resistance through SA mediated interaction with NPR1 (Fan et al2002, Fu et al 2013. TGA family member PERIANTHIA (PAN/bZIP46) plays a role in ower development, interact with ROXY-type GRX (CC-type glutaredoxin, GRX-ROXY1) gene to regulate petal development (Gatz 2013, Gutsche et al 2017). Recently, Ullah et al 2019 studied soybean TGA family genes and differentiated legumes-speci c TGAs structures, involvement in legumes-speci c biological processes like legumes-rhizobia symbiotic nodulation and predicted soybean bZIPs role in response to nitrogen.…”

Section: Introductionmentioning

confidence: 99%

Version 4.3-12/08/20 Cotton bZIP Transcription Factors: Characterization of the bZIP Family From Gossypium Hirsutum, Gossypium Arboreum and Gossypium Raimondii

Khanale

Bhattacharya

Satpute³

et al. 2020

Preprint

View full text Add to dashboard Cite

BackgroundCotton is an important commodity in the world economy. In this study we have carried out genome-wide identification and bioinformatics characterization of basic leucine zipper domain proteins (bZIPs) from cultivated cotton species G. hirsutum along with two subgenome species of allotetraploid cotton, G. arboreum and G. raimondii. Transcription factors (TFs) are the key regulators in plant development and stress adaptation. Understanding interactions of TFs in cotton crop is important for enhancing stress tolerance and yield enhancement. Among plant TFs, bZIPs plays a major role in seed germination, flower development, biotic and abiotic stress response. Most of the bZIP proteins from cotton remains uncharacterized and can be utilised for crop improvement. In this paper we performed genome-wide identification, phylogenetic analysis, structural characterization and functional role prediction of bZIPs from all three genome species of cotton.ResultsIn the present study genome-wide identification, phylogenetic analysis, structural characterization and functional role prediction of bZIP TFs from G. hirsutum (AADD) along with two subgenome species G. arboreum (A2) and G. raimondii (D5) were performed. A total of 228 bZIP genes of G. hirsutum, 91 bZIP genes of G. arboreum and 86 bZIP genes of G. raimondii were identified from CottonGen database. Cotton bZIP genes were annotated in standard pattern according to their match with Arabidopsis bZIPs. Multiple genes with similar bZIP designations were observed in cotton. Cotton bZIPs are distributed across all 13 chromosomes with varied density. Phylogenetic characterization of all three cotton species bZIPs with Arabidopsis bZIPs classified them into 12 subfamilies, namely A B, C, D, E, F, G, H, I, J, K and S and further into eight subgroups according to functional similarities, viz., A1, A2, A3, C1, C2, S1, S2 and S3.The classification was exclusively based on alignment with Arabidopsis bZIPs further supported by structural characteristics like exon number, amino acid length, common functional motifs shared among subfamilies and basic leucine zipper domain (BRLZ) alignment. Subfamily A and S are having maximum number of bZIP genes, subfamily B, H, J and K are single member families. Cotton is carrying only bZIP17 among the group of bZIP17, 28 and 49 which are known to be crucially worked under endoplasmic reticulum (ER) stress. Cotton bZIP protein functions were predicted from identified motifs and orthologs from varied species.MEME motif analysis identified MYND-Zinc binding domain, tetratricopeptide repeats motif, GluR7, DOG1, (DELAY OF GERMINATION 1) seed dormancy control motif, TGACG sequence specific motif, etc. specifically in some of the subfamily members and presence of bZIP signature domain in all identified bZIPs. Further we explored the BRLZ domain of G. raimondii bZIPs, conserved basic region motif N-X7-R/K is present in almost all subfamily members, variants are GrbZIP62 which is carrying N-X7-I motif and GrbZIP76 with K-X7-R motif. Leucine heptad repeats motif, L-X6-L-X6-L are also present in variant numbers from two to nine with leucine or other hydrophobic amino acid at designated position among 12 subfamily members.STRING protein interaction network analysis of G.raimondii bZIPs observed strong interaction between A-D subfamily members, C-S subfamily members and between GrbZIP17- GrbZIP60. NLS analysis of G. raimondii bZIPs observed conserved NLS sequences among subfamilies.ConclusionThis study analyzed, annotated and phylogenetically classified bZIP proteins from cultivated cotton species G. hirsutum along with two subgenome species G. arboreum and G. raimondii. Cotton bZIPs are classified into twelve subfamilies and eight subgroups. bZIP gene duplications are observed in all three cotton species. We have identified conserved functional motifs among different subfamilies of cotton bZIP proteins and correlated for the prediction of function along with reported function. Explored BRLZ domain structural analysis of G. raimondii bZIPs will be useful in further basic characterization of bZIP proteins of cultivated cotton species G. hirsutum. STRING protein interaction analysis of G. raimondii bZIPs resulted in prediction of interactions among A- D, B-K and C-S subfamily members. Phylogenetic analysis of this study will certainly help in the selection of specific cotton bZIP genes according to the close alignment with Arabidopsis orthologs or subgenome homolog.

show abstract

Conserved redox‐dependent DNA binding of ROXY glutaredoxins with TGA transcription factors

Cited by 34 publications

References 73 publications

Transformation of Riccia fluitans, an Amphibious Liverwort Dynamically Responding to Environmental Changes

Transformation of Riccia fluitans, an Amphibious Liverwort Dynamically Responding to Environmental Changes

MpTCP1 controls cell proliferation and redox processes in Marchantia polymorpha

Version 4.3-12/08/20 Cotton bZIP Transcription Factors: Characterization of the bZIP Family From Gossypium Hirsutum, Gossypium Arboreum and Gossypium Raimondii

Contact Info

Product

Resources

About