Constitutive IRAK4 Activation Underlies Poor Prognosis and Chemoresistance in Pancreatic Ductal Adenocarcinoma

Abstract

Purpose Aberrant activation of the NF-κB transcription factors underlies the aggressive behavior and poor outcome of pancreatic ductal adenocarcinoma (PDAC). However, clinically effective and safe NF-κB inhibitors are not yet available. Because NF-κB transcription factors can be activated by the Interleukin-1 Receptor-Associated Kinase (IRAK) downstream of the Toll-like receptors (TLRs), but has not been explored in PDAC, we sought to investigate the role of IRAK in the pathobiology of PDAC. Experimental Design We examined the phosphorylation status of IRAK4 (p-IRAK4), the master regulator of TLR signaling, in PDAC cell lines, in surgical samples and commercial tissue microarray. We then performed functional studies using small molecule IRAK1/4 inhibitor, RNA-interference and CRISPR/Cas9n techniques to delineate the role of IRAK4 in NF-κB activity, chemoresistance, cytokine production and growth of PDAC cells in vitro and in vivo. Results p-IRAK4 staining was detectable in the majority of PDAC lines and about 60% of human PDAC samples. Presence of p-IRAK4 strongly correlated with phospho-NF-κB/p65 staining in PDAC samples and is predictive of postoperative relapse and poor overall survival. Inhibition of IRAK4 potently reduced NF-κB activity, anchorage-independent growth, chemoresistance and secretion of pro-inflammatory cytokines from PDAC cells. Both pharmacologic suppression and genetic ablation of IRAK4 greatly abolished PDAC growth in mice and augmented the therapeutic effect of gemcitabine by promoting apoptosis, reducing tumor cell proliferation and tumor fibrosis. Conclusions Our data established IRAK4 as a novel therapeutic target for PDAC treatment. Development of potent IRAK4 inhibitors is needed for clinical testing.

IRAK4 mediates colitis-induced tumorigenesis and chemoresistance in colorectal cancer

“…Supporting our results using shRNAs, both IRAK4 inhibitors suppressed clonogenic growth of CRC cells ( Figure 5C). Notably, while IRAK4 inhibitors did not suppress growth of SW80 and SW620 cells in monolayer culture, they potently suppressed clonogenic growth of these cells, implying engagement and need for IRAK4 and NF-κB activation in stress-induced conditions, as we previously reported in pancreatic cancer cells (26). Both IRAK4 inhibitors potently blocked p-IRAK1, p-p50, nuclear translocation of p65, and NF-κB-driven luciferase reporter activity dose-dependently in CRC cells ( Figure 5, D-F).…”

“…Antibodies used for IHC and immunofluorescence (IF) staining are provided in Supplemental Table 2. Unless otherwise specified, all IF quantification was performed under fluorescence or light microscopy on ten ×20-power fields per tumor, and data are presented as mean ± SEM, as previously described (26). For all TMA image analysis, whole slide tissue scans were obtained at ×20 magnification on a Zeiss Axio Scan Z1 Brightfield/Fluorescence Slide Scanner (resolution 0.645 μm per pixel).…”

“…Plasmids and creation of stable cell lines. Stable knockdowns were generated using pSuperRetro as previously described (26). Target sequences were: shIRAK4#1, TTCAGTAGTAATGTCAACC; shIRAK4#2, GCCTAATGGTTCATTGCTA; shTLR9#1, GAGCTAAACCTGAGCTACAAC; shTLR9#2, GCAC-GGTGCCACCTCCACACT.…”

“…Ligation of these receptors results in recruitment and assembly of the adaptor protein MyD88 and IL-1 receptor-associated kinase (IRAK) isoforms 1, 2, and 4, leading to activation of TAK1 kinase and subsequently the IKK complex and NF-κB (18). Therapeutic value of targeting the IRAK members, specifically the IRAK1 and IRAK4 isoforms, has been elucidated in several cancer types, including diffuse large B cell lymphoma (DLBCL) (19,20), myelodysplastic syndrome (21), T cell acute lymphoblastic leukemia (22), melanoma (23), breast cancer (24), and head and neck cancer (25), and in pancreatic cancer by our group (26,27). In pancreatic cancer, IL-1β secreted by both neoplastic cells and fibroblasts activates the IRAK4/ NF-κB axis to foster tumor fibrosis, which contributes to chemoresistance.…”

Differential role of Interleukin-1 and Interleukin-6 in K-Ras-driven pancreatic carcinoma undergoing mesenchymal transition

“…40 A number of studies demonstrated that IL-1-mediated constitutive activation of NF-kB occurs in pancreatic tumors, and is a requirement for tumor development. 16,[41][42][43] When we blocked IL-1R signaling with Anakinra (IL-1R antagonist), we found strong inhibition of IL-6 and CXCL8 production only in cells with epithelial phenotype. In vivo, Anakinra-treated mice had significant inhibition of tumor growth and lower infiltration of macrophages and vessels.…”