Construction and analysis of<i>luxCDABE</i>-based plasmid sensors for investigating<i>N</i>-acyl homoserine lactone-mediated quorum sensing

Winson, Michael K.; Swift, Simon; Fish, Leigh; Throup, John; Jørgensen, Frieda; Chhabra, Siri Ram; Bycroft, Barrie W.; Williams, Paul; Stewart, Gordon S. A. B.

doi:10.1111/j.1574-6968.1998.tb13044.x

Cited by 526 publications

(212 citation statements)

References 19 publications

Supporting

Mentioning

208

Contrasting

Order By: Relevance

“…Sequence 5'-3' Reference C. albicans_HWP1F CCACTACTACTGAAGCCAAATC [31] C. albicans_HWP1R AAGTGGATACTGTACCAGTTGG [31] C. albicans_SAP5F ACTTCTGTAAGAGTGCTGGTTC [31] C. albicans_SAP5R TGTCGTAATCAAACTCGGTAGC [31] C. albicans_GPD1F AGTATGTGGAGCTTTACTGGGA [31] C. albicans_GPD1R CAGAAACACCAGCAACATCTTC [31] [66] Vibrio harveyi BB120 wild-type [67] V. harveyi BB170 Km r ; luxN::Tn5; AI-1 + AI-2 + (sensor for AI-2) ATCC BAA-1117 V. harveyi BB886 Km r ; luxPQ::Tn5; AI-1 + AI-2 À (sensor for AI-1) [67] Escherichia coli MT102 pSB403 Plasmid: Tc r ; LuxR and P luxI from V. fischeri; luxCDABE from Photorhabdus luminescens; luciferase based sensor for short-chain AHLs [68] E. coli MT102 pJBA132…”

Section: Primermentioning

confidence: 99%

Streptococcus mutans Inhibits Candida albicans Hyphal Formation by the Fatty Acid Signaling Molecule trans‐2‐Decenoic Acid (SDSF)

et al. 2010

View full text Add to dashboard Cite

In the human mouth, fungi and several hundred species of bacteria coexist. Here we report a case of interkingdom signaling in the oral cavity: A compound excreted by the caries bacterium Streptococcus mutans inhibits the morphological transition from yeast to hyphae, an important virulence trait, in the opportunistic fungus Candida albicans. The compound excreted by S. mutans was originally studied because it inhibited signaling by the universal bacterial signal autoinducer-2 (AI-2), determined by the luminescence of a Vibrio harveyi sensor strain. The inhibitor was purified from cell-free culture supernatants of S. mutans guided by its activity. Its chemical structure was elucidated by using NMR spectroscopy and GC-MS and proved to be trans-2-decenoic acid. We show that trans-2-decenoic acid does not inhibit AI-2-specific signaling, but rather the luciferase reaction used for its detection. A potential biological role of trans-2-decenoic acid was then discovered. It is able to suppress the transition from yeast to hyphal morphology in the opportunistic human pathogen Candida albicans at concentrations that do not affect growth. The expression of HWP1, a hyphal-specific signature gene of C. albicans, is abolished by trans-2-decenoic acid. trans-2-Decenoic acid is structurally similar to the diffusible signal factor (DSF) family of interkingdom-signaling molecules and is the first member of this family from a Gram-positive organism (Streptococcus DSF, SDSF). SDSF activity was also found in S. mitis, S. oralis, and S. sanguinis, but not in other oral bacteria. SDSF could be relevant in shaping multispecies Candida bacteria biofilms in the human body.

show abstract

Section: Primermentioning

confidence: 99%

Streptococcus mutans Inhibits Candida albicans Hyphal Formation by the Fatty Acid Signaling Molecule trans‐2‐Decenoic Acid (SDSF)

et al. 2010

View full text Add to dashboard Cite

show abstract

“…LuxR homologues are most specific for their cognate AHL, but many can also be activated by other related compounds. A practical demonstration of this phenomenon is through the use of a range of bioluminescent biosensors based on the V. fischeri (luxI/R), P. aeruginosa (lasI/R) and Aeromonas hydrophila (ahyI/R) luxR/I homologues ( pSB401, pSB1075 and pSB536, respectively) (Swift et al 1997;Winson et al 1998;Steindler & Venturi 2007). These plasmids contain the promoter region of the appropriate luxI homologue along with the response regulator fused to luxCDABE.…”

Section: Quorum-sensing-mediated Signal Interception and Coercionmentioning

confidence: 99%

“…These plasmids contain the promoter region of the appropriate luxI homologue along with the response regulator fused to luxCDABE. While each reporter responds optimally to its cognate AHL to produce light, each also reports the presence of other signals that are structurally related to the cognate AHL (normally differing in the number of carbons in the fatty acyl chain) (Bainton et al 1992a;Winson et al 1998;Kirke et al 2004). Although these biosensors are engineered for in vitro use, they demonstrate an important point that the signal generated by one species can be detected by another species that does not synthesize the same signal molecule.…”

Section: Quorum-sensing-mediated Signal Interception and Coercionmentioning

confidence: 99%

Quorum sensing and social networking in the microbial world

Atkinson

Williams

2009

J. R. Soc. Interface.

Self Cite

368

240

View full text Add to dashboard Cite

For many years, bacterial cells were considered primarily as selfish individuals, but, in recent years, it has become evident that, far from operating in isolation, they coordinate collective behaviour in response to environmental challenges using sophisticated intercellular communication networks. Cell-to-cell communication between bacteria is mediated by small diffusible signal molecules that trigger changes in gene expression in response to fluctuations in population density. This process, generally referred to as quorum sensing (QS), controls diverse phenotypes in numerous Gram-positive and Gram-negative bacteria. Recent advances have revealed that bacteria are not limited to communication within their own species but are capable of 'listening in' and 'broadcasting to' unrelated species to intercept messages and coerce cohabitants into behavioural modifications, either for the good of the population or for the benefit of one species over another. It is also evident that QS is not limited to the bacterial kingdom. The study of two-way intercellular signalling networks between bacteria and both uni-and multicellular eukaryotes as well as between eukaryotes is just beginning to unveil a rich diversity of communication pathways.

show abstract

“…Specifically, we examined the accumulation of C 4 -HSL, 3OC 12 -HSL, and PQS both intracellularly and extracellularly at the transition to stationary phase (6 h) just before visible pigmentation in P2. Cell-free conditioned media and cell lysates were analyzed for QS molecule production using E. coli (27) and P. aeruginosa (28) reporter strains for C 4 -HSL, 3OC 12 -HSL, and PQS activity. The data were normalized to either cell density (for extracellular measurements) or protein concentration (for intracellular measurements).…”

Section: Mpao1-p2 Demonstrates Early Activation Of Quorum Sensingmentioning

confidence: 99%

“…Luminescence measured after 2 h of reporter strain incubation was normalized to protein concentration. The following reporter strains were used: for C 4 -HSL, E. coli harboring the reporter plasmid pSB536 (27); for 3OC 12 -HSL, E. coli harboring the reporter plasmid pSB1705 (27); and for PQS, P. aeruginosa ⌬PqsA/pqsA::luxCDABE (28).…”

mentioning

confidence: 99%

Emergence of the P2 Phenotype in Pseudomonas aeruginosa PAO1 Strains Involves Various Mutations in mexT or mexF

Luong

Shogan

Zaborin

et al. 2013

Journal of Bacteriology

View full text Add to dashboard Cite

We recently demonstrated that Pseudomonas aeruginosa PAO1 undergoes a pronounced phenotypic change when introduced into the intestines of rats during surgical injury. Recovered strains displayed a specific phenotype (termed the P2 phenotype) characterized by altered pyocyanin production, high collagenase activity, high swarming motility, low resistance to chloramphenicol, and increased killing of Caenorhabditis elegans compared to the inoculating strain (termed the P1 phenotype). The aims of this study were to characterize the differences between the P. aeruginosa P1 and P2 phenotypes in quorum sensing and competitiveness. We then determined the presence of the P2 phenotype among PAO1 strains from various laboratories. Results demonstrated that P2 cells display accelerated growth during early exponential phase and early activation of quorum-sensing systems and overcome the growth of P1 cells in a mixed population. Among eight PAO1 strains obtained from different laboratories, four exhibited the P2 phenotype. Of 27 mutants analyzed from the P. aeruginosa MPAO1 transposon library, 25 displayed P2 phenotypes. The P2 phenotype in both cases correlated with a lack of expression of mexE or mexF due to mutations in mexT and mexF genes. In summary, strains possessing the P2 phenotype are distributed among PAO1 strains commonly used across a variety of research laboratories. Genetically, they are characterized by various mutations in mexT or mexF. Stable genetic mutations that change phenotypes can arise as microbes adapt to their environment to maximize propagation. This ecologically dependent shift in phenotype has been documented in many bacterial species and in diverse contexts (1, 2). Recently, we demonstrated that the MPAO1 strain of Pseudomonas aeruginosa became transformed to (or selected for) a more virulent phenotype when present in the colon of rats subjected to preoperative radiation followed by colon resection and anastomosis (3). The strain recovered from the anastomotic tissue (termed MPAO1-P2, i.e., having the P2 phenotype) exhibited high collagenase activity, swarming ability, increased pyocyanin production in liquid medium, and increased tissue-destroying capacity compared to the initial strain (termed MPAO1-P1, having the P1 phenotype). Comparative genomic sequencing analysis revealed that MPAO1-P2 harbored a single-nucleotide polymorphism (SNP) in the mexT gene that results in a truncated and nonfunctional MexT protein. Transformation of mexT-P1 into MPAO1-P2 reverted the strain back to the P1 phenotype. The phenotypes of P. aeruginosa that are similar to P1 and P2 have been previously described (4-7). In the cited studies, the wild-type PAO1 strain harbored an 8-bp insertion in mexT that results in a nonfunctional MexT protein and a phenotype similar to P2. Its derivative mutant that was selected by norfloxacin (referred to as a nfxC-type mutant) had a functional MexT protein and was characterized by attenuated pyocyanin production (5), high resistance to chloramphenicol (6), and absence of swarming ...

show abstract

Construction and analysis ofluxCDABE-based plasmid sensors for investigatingN-acyl homoserine lactone-mediated quorum sensing

Cited by 526 publications

References 19 publications

Streptococcus mutans Inhibits Candida albicans Hyphal Formation by the Fatty Acid Signaling Molecule trans‐2‐Decenoic Acid (SDSF)

Streptococcus mutans Inhibits Candida albicans Hyphal Formation by the Fatty Acid Signaling Molecule trans‐2‐Decenoic Acid (SDSF)

Quorum sensing and social networking in the microbial world

Emergence of the P2 Phenotype in Pseudomonas aeruginosa PAO1 Strains Involves Various Mutations in mexT or mexF

Contact Info

Product

Resources

About