Construction of a Radiation Hybrid Map of Chromosome 9p

Presence on human chromosome 10 of omeprazole-sensitivity gene whose product mediates CYP1A1 induction

“…HepG2 cells were exposed to 80 Gy of irradiation at room temperature using a Hitachi MBR1520R X-ray unit (Bouzyk et al, 1996). They were then fused with Hepa-1/6TG r cells, as described above.…”

“…Because different hybrid cell lines contain different sets of human chromosomes, by analyzing several hybrid cell lines we can narrow down the human chromosome that harbors a responsible gene for CYP1A1 induction by omeprazole treatment. Furthermore, we can localize the gene on the chromosome using radiation hybrid cells, which contain human chromosomes fragmented by X-ray irradiation (Bouzyk et al, 1996).…”

Integrated Radiation Hybrid and Yeast Artificial Chromosome Map of Chromosome 9p

“…The 96-well 'microtiter format' was used with a Beckman 1000 Biomek robot to aliquot DNA for rapid PCR analysis. Primer sequences for all DNA fragment markers, ESTs and genes can be found in GDB (URL http://gdbwww.gdb.org/) or by referring to Bouzyk et al [21]. Primers 5'TACACCAGGATCAAG-AAGGC3' and 5 AGAGAAACCGAGAAGAAACC3' for RD55 were designed by Vivienne Watson [pers.…”

“…Polymerase Chain Reaction RH clones had been previously characterized by T/«-specific PCR for human content [21], The presence or absence of single-copy loci in the RH or YAC panels was determined by PCR. Each marker was screened in duplicate.…”

“…More recently, the constitutional 9p syn drome was located between D9S267 and D9S286, and a sex determination gene was placed between SNF2L2 and D9S144 [1], Several maps which include chromosome 9p as a com ponent of genome-wide efforts have been published. These include genetic linkage maps based on meiotic recombination in the CEPH families [14][15][16], a Géné-thon-Cambridge University radiation hybrid (RH) map [17], a CEPH YAC map [18], an integrated sequence-tag ged site (STS) YAC-RH map produced by the Whitehead Institute and Généthon [ 19] and a gene map produced by an intemationl consortium [20], We wished to exploit the information on these maps by firstly improving on the previously published RH map of chromosome 9p [21] with the addition of new markers on the framework map and subsequently refining the localization of these and previous markers. The second step would be to use this new and improved RH map as a basis for constructing a YAC minimal tiling path across the whole of the short arm of chromosome 9.…”