Copper-Induced Activation of MAPKs, CDPKs and CaMKs Triggers Activation of Hexokinase and Inhibition of Pyruvate Kinase Leading to Increased Synthesis of ASC, GSH and NADPH in Ulva compressa

Abstract

In order to analyze whether copper induces activation of CaMK, CDPK and/or MAPK signaling pathways leading to carbon flux reprogramming and to the synthesis of ascorbate (ASC), glutathione (GSH) and NADPH in order to buffer copper-induced oxidative stress, U. compressa was initially cultivated with 10 µM copper for 0 to 10 days. The activities of hexokinase (HK), pyruvate kinase (PK), L-galactone 1,4 lactone dehydrogenase (L-GLDH) and glucose 6-P dehydrogenase (G6PDH) were analyzed. HK activity was increased whereas PK was inhibited, and L-GLDH and G6PDH activities were increased indicating a copper-induced modulation of glycolysis leading to carbon flux reprogramming. Then, the alga was cultivated with an inhibitor of CaMs and CaMKs, CDPKs and MAPKs, and with 10 µM of copper for 5 days and the activities of HK, PK, L-GLDH, G6PDH and glutathione synthase (GS), the levels of ASC/DHA, GSG/GSSG and NADPH/NADP, the levels of superoxide anions (SA) and hydrogen peroxide (HP) and the integrity of plasma membrane were determined. The activation of HK was dependent on MAPKs, the inhibition of PK on CDPKs/MAPKs, the activation of L-GLDH on MAPKs, the activation GS on CDPKs/MAPKs, and the activation of G6PDH on MAPKs. Increases in the level of ASC/DHA were dependent on activation of CaMKs/CDPKs/MAPKs, those of GSG/GSSG on MAPKs and those NADPH/NADP on CaMKs/CDPKs/MAPKs. The accumulation of superoxide anions and hydrogen peroxide and the integrity of plasma membrane were dependent on CaMKs/CDPKs/MAPKs. Thus, copper induced the activation of MAPKs, CDPKs and CaMKs leading to the modulation of glycolysis and carbon flux reprogramming which trigger an increase in ASC, GSH and NADPH syntheses and the activation of antioxidant enzymes in order to buffer copper-induced oxidative stress in U. compressa.

Cadmium Accumulation Involves Synthesis of Glutathione and Phytochelatins, and Activation of CDPK, CaMK, CBLPK, and MAPK Signaling Pathways in Ulva compressa

“…Tubulin-β was used as housekeeping gene since the levels of transcripts did not change under cadmium stress in U. compressa (D. Laporte, personal communication). PCR primers were designed based on previously obtained transcriptomes of U. compressa (Laporte et al, 2016(Laporte et al, , 2020a and they were: TUB-F: 5 TGCAACTTTTGTAGGCAACTC3 and TUB-R: 5 CAGTGAACTCCATCTCGTCC3 ; UcMT1-F: 5 CCAGTGCC AAACCGAAGATG3 and UcMT1-R: 5 TGCTAGCAG GCACAGTCGTC3 ; UcMT2-F: 5 GCACTCCTGAGACCT GCACT3 and UcMT3-R: 5 ATCCTTCGCGGGTGAGCAAG3 ; UcMT3-F: 5 TCTTGTTGTGAAGCAAGTGA3 and UcMT3-R: 5 CACAGTTGCATTCTGCGGTT3 . Amplification was performed for 5 s at 95 • C, 10 s at 54 • C for tubulin, or 10 s at 56 • C for UcMTs, and 40 cycles of amplification in all cases.…”

Molecular Response of Ulva prolifera to Short-Term High Light Stress Revealed by a Multi-Omics Approach

“…The growth and distribution of algae are affected by many environmental factors such as temperature, light, and chemicals in the water. Relevant studies have gradually discovered algae stress-related proteins that resist adversity stress [ 79 , 80 ]. In this study, dnaJ protein.…”

Network Pharmacology-Based Strategy to Reveal the Mechanism of Cassiae Semen against Cataracts

“…The thyroid hormone signaling pathway participates in the regulation of growth, development, and glucose metabolism. The modulation of glycolysis and carbon flux reprogramming can increase the glutathione (GSH) syntheses and activate the antioxidant enzymes [ 54 ], which are beneficial for protecting the lens from oxidative stress leading to opacification. A previous study has reported a decrease in lenticular GSH levels that occurred during the formation of most cataracts [ 55 ].…”