Copper-Induced Translocation of the Wilson Disease Protein ATP7B Independent of Murr1/COMMD1 and Rab7

Abstract

Wilson disease is a genetic disorder of copper metabolism. Impaired biliary excretion results in a gradual accumulation of copper, which leads to severe disease. The specific gene defect lies in the Wilson disease protein, ATP7B, a copper-transporting ATPase that is highly active in hepatocytes. The two major functions of ATP7B in the liver are the copper loading of ceruloplasmin in the Golgi apparatus, and the excretion of excess copper into the bile. In response to elevated copper levels, ATP7B shows a unique intracellular trafficking pattern that is required for copper excretion from the Golgi apparatus into dispersed vesicles. We analyzed the translocation of ATP7B by both confocal microscopy and RNA interference, testing current models that suggest the involvement of Murr1/COMMD1 and Rab7 in this pathway. We found that although the ATP7B translocation is conserved among nonhepatic cell lines, there is no co-localization with Murr1/COMMD1 or the Rab marker proteins of the endolysosomal system. Consistent with this finding, the translocation of ATP7B was not impaired by the depletion of either Murr1/COMMD1 or Rab7, or by a dominant-negative Rab7 mutant. In conclusion, our data suggest that the translocation of ATP7B takes place independently of Rab7-regulated endosomal traffic events. Murr1/COMMD1 plays a role in a later step of the copper excretion pathway but is not involved in the translocation of the Wilson disease protein.

Copper Metabolism Domain-Containing 1 Represses Genes That Promote Inflammation and Protects Mice From Colitis and Colitis-Associated Cancer

“…The data indicate that COMMD1 expression in the myeloid compartment plays an important role in the regulation of inflammatory responses in vivo . Given that diverse functions have been reported for this gene, 17, 38–40 this report fills a critical void by underscoring that COMMD1 participates in immune regulation. In addition, the results also suggest that COMMD1 has broader effects on pro-inflammatory gene expression programs that might extend beyond the NF-κB pathway.…”

The N-terminal region of acyl-CoA synthetase 3 is essential for both the localization on lipid droplets and the function in fatty acid uptake

“…Measurement of mRNA expression was by calibrator-normalized effi ciency corrected relative quantifi cation using the LightCycler system (Roche, Mannheim, Germany) as described ( 25 ). The reference gene was human ␤ -actin (primer, 5 ′ -3 ′ orientation: AGGATGCAGAAGGAGATCACT; GGGTGTAACGCAACTAAGT-CATAG).…”

“…A3 Nt -RFP is comprised of amino acids 1-135 of human ACSL3 followed by mRFP. For this, the plasmid A3 Nt -GFP was digested with Hin dIII and BamHI and ligated into Murr1-RFP.pcDNA3 ( 25 ); this replaced the Murr1 cDNA and yielded a cDNA containing monomeric RFP in frame ( 26 ). Transcription of the ACSL3 RNAi plasmid generates a small hairpin RNA.…”

Basolateral sorting and transcytosis define the Cu+-regulated translocation of ATP7B to the bile canaliculus

“…Increased Cu + levels in the hepatocyte result in the release of the ATP7B that has been sequestered in the trans-Golgi network (TGN) and its relocation to other membrane compartments. However, although the direct relocalization of ATP7B to the bile canaliculus would appear to be the most likely trafficking route, studies on the Cu + -induced relocation of ATP7B have resulted in identification of other membrane targets, including late endosomes and lysosomes (Harada et al, 2003a;Polishchuk et al, 2014;Weiss et al, 2008). In addition, a stable pool of ATP7B has been located at tight junctions (Hernandez et al, 2008).…”