Cordycepin attenuates traumatic brain injury-induced impairments of blood-brain barrier integrity in rats

Yuan, Jing; Wang, Aihua; He, Yan; Si, Zhihua; Xu, Shan; Zhang, Shanchao; Wang, Kun; Wang, Dawei; Liu, Yiming

doi:10.1016/j.brainresbull.2016.09.010

Cited by 46 publications

(30 citation statements)

References 27 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Increases in TJ protein levels are beneficial for the integrity of the BBB . Protection against BBB‐integrity damages induced by TBI is probably achieved through the recovery of TJ proteins . In this study, Cb treatment improved BBB impairment induced by TBI in mice.…”

Section: Discussionmentioning

confidence: 60%

Clostridium butyricum exerts a neuroprotective effect in a mouse model of traumatic brain injury via the gut‐brain axis

Sun

et al. 2017

Neurogastroenterology Motil

128

View full text Add to dashboard Cite

show abstract

Section: Discussionmentioning

confidence: 60%

Clostridium butyricum exerts a neuroprotective effect in a mouse model of traumatic brain injury via the gut‐brain axis

Sun

et al. 2017

Neurogastroenterology Motil

128

View full text Add to dashboard Cite

show abstract

“…; Yuan et al . ), primers for each gene were as follows: zonula occludens protein‐1 (ZO‐1; 5′‐CGGTCCTCTGAGCCTGTAAG‐3′; 5′‐GGATCTACATGCGACGACAA‐3′); occludin (5′‐GCTCAGGGAATATCCACCTATCA‐3′; 5′‐CACAAAGTTTTAACTTCCCAGACG‐3′); interleukin (IL)‐1β (5′‐CACCTCTCAAGCAGAGCACAG‐3′; 5′‐GGGTTCCATGGTGAAGTCAAC‐3′); inducible nitric oxide synthase (iNOS; 5′‐CCACAATAGTACAATACTACTTGG‐3′; 5′‐ACGAGGTGTTCAGCGTGCTCCACG‐3′); IL‐6 (5′‐CCAAAGTTCCTGACTTGTTTG‐3′, 5′‐GTTGTTCTTCACAAACTCC‐3′); and arginase 1 (5′‐AAGAAAAGGCCGATTCACCT‐3′; 5′‐CACCTCCTCTGCTGTCTTCC‐3′); GAPDH (5′‐ATCACCATCTTCCAGGAGCG‐3′; 5′‐TTCTGAGTGGCAGTGAGGGC‐3′). The relative amount of target gene was calculated using the

2^{- normalΔ normalΔ C_{t}}

method.…”

Section: Methodsmentioning

confidence: 99%

“…Quantitative PCR was performed using SYBR Premix Ex Taq (Takara Bio Inc., Dalian, China) on all 10 animals in an ABI 7500 Real-Time PCR System (Applied Biosystems, Waltham, MA, USA). Referring to previous studies (Shi et al 2015;Yuan et al 2016), primers for each gene were as follows: zonula occludens protein-1 (ZO-1; 5 -CG GTCCTCTGAGCCTGTAAG-3 ; 5 -GGATCTACATGCG ACGACAA-3 ); occludin (5 -GCTCAGGGAATATCCA CCTATCA-3 ; 5 -CACAAAGTTTTAACTTCCCAGACG-3 ); interleukin (IL)-1β (5 -CACCTCTCAAGCAGAGCA CAG-3 ; 5 -GGGTTCCATGGTGAAGTCAAC-3 ); inducible nitric oxide synthase (iNOS; 5 -CCACAATAGTA CAATACTACTTGG-3 ; 5 -ACGAGGTGTTCAGCGTGC TCCACG-3 ); IL-6 (5 -CCAAAGTTCCTGACTTGTTT G-3 , 5 -GTTGTTCTTCACAAACTCC-3 ); and arginase 1 (5 -AAGAAAAGGCCGATTCACCT-3 ; 5 -CA CCTCCTCTGCTGTCTTCC-3 ); GAPDH (5 -ATCACCA TCTTCCAGGAGCG-3 ; 5 -TTCTGAGTGGCAGTGAGG GC-3 ). The relative amount of target gene was calculated using the 2 − C t method.…”

Section: Quantitative Rt-pcr Analysismentioning

confidence: 98%

Catechin attenuates traumatic brain injury‐induced blood–brain barrier damage and improves longer‐term neurological outcomes in rats

Jiang

Zhang

Cai

et al. 2017

Experimental Physiology

View full text Add to dashboard Cite

What is the central question of this study? We investigated the potential neuroprotective effects of catechin after traumatic brain injury and explored the underlying mechanisms. What is the main finding and its importance? Catechin treatment had neuroprotective effects in a rat model of traumatic brain injury, and these effects might be mediated by intervention in the self-perpetuating process of blood-brain barrier disruption and excessive inflammatory reaction. Traumatic brain injury (TBI) resulting from external force on the head usually leads to long-term deficits in motor and cognitive functions. Catechin has shown neuroprotective effects in neurodegenerative diseases and ischaemia models. We therefore investigated the potential neuroprotective effects of catechin after TBI and explored the underlying mechanisms. Male rats were subjected to controlled cortical impact injury and then treated with catechin. Brain damage, motor and cognitive functions, blood-brain barrier (BBB) integrity and neuro-inflammation were examined. Catechin treatment ameliorated brain damage and motor and cognitive deficits after TBI. Catechin was shown to protect BBB integrity, alleviate the TBI-induced loss of the junction proteins occludin and zonula occludens protein-1 and suppress local inflammatory reactions. Catechin treatment had neuroprotective effects in a rat model of TBI, and these effects might be mediated by intervention in the self-perpetuating process of BBB disruption and excessive inflammatory reaction.

show abstract

“…TUNEL-positive expression was detected via 1000 cells in random fields. 5 BioMed Research International of NOX1 and NOX2 were detected as previously reported [18]. In brief, a 20 μl supernatant of homogenized and centrifuged colon samples was added into a 96-well luminescence plate, then mixed with 80 μl PBS and 6.25 μl l M lucigenin.…”

Section: Apoptosismentioning

confidence: 99%

Protective Effect of Iridoid Glycosides of the Leaves of Syringa oblata Lindl. on Dextran Sulfate Sodium-Induced Ulcerative Colitis by Inhibition of the TLR2/4/MyD88/NF-κB Signaling Pathway

Han

et al. 2020

BioMed Research International

View full text Add to dashboard Cite

Iridoid glycoside (IG) is the major active fraction extracted from the leaves of Syringa oblata Lindl. In view of its antimicrobial and antidiarrheal potential, it could be beneficial for the treatment of ulcerative colitis (UC). In the present study, IG (20, 40, and 80 mg/kg) was administered orally for 14 days to dextran sulfate sodium- (DSS-) induced colitis rats. The anti-inflammatory effects of IG on DSS-induced UC were evaluated by comparing observations in DSS-induced colitis and drug-treated groups using disease activity index (DAI), macroscopic score, histological analysis, and apoptosis assay. To elucidate the antioxidant mechanisms of IG on NOX-dependent ROS production, the activities of 8-OHdG, NOX1, and NOX2 in DSS-induced colitis were determined. The levels of proinflammatory cytokines such as IL-2, IL-4, IL-5, IL-12p40, and IL-13 were detected. The inflammation-associated protein and mRNA expressions of TLR-2, TLR-4, MyD88, and NF-κBp65 were assessed by immunohistochemistry and real-time quantitative PCR, respectively. The results suggested that IG treatment significantly reduced DAI, macroscopic score, and histological damage compared to untreated animals (p<0.01), whereas administration of IG remarkably attenuated the upregulation of 8-OHdG, NOX1, and NOX2 and the expression of proinflammatory cytokines such as IL-2, IL-4, IL-5, IL-12p40, and IL-13 in DSS-treated rats in a concentration-dependent manner. In addition, IG treatment could dose dependently suppress the protein and mRNA levels of TLR-2, TLR-4, MyD88, and NF-κBp65. The dose of IG that produced the most significant protective effect was 80 mg/kg. The above results demonstrate that IG exerts its inhibitory effect on cell apoptosis, oxidative stress, and proinflammatory cytokines in DSS-induced colitis through modulation of the TLR2/4/MyD88/NF-κB signaling pathway.

show abstract

Cordycepin attenuates traumatic brain injury-induced impairments of blood-brain barrier integrity in rats

Cited by 46 publications

References 27 publications

Clostridium butyricum exerts a neuroprotective effect in a mouse model of traumatic brain injury via the gut‐brain axis

Clostridium butyricum exerts a neuroprotective effect in a mouse model of traumatic brain injury via the gut‐brain axis

Catechin attenuates traumatic brain injury‐induced blood–brain barrier damage and improves longer‐term neurological outcomes in rats

Protective Effect of Iridoid Glycosides of the Leaves of Syringa oblata Lindl. on Dextran Sulfate Sodium-Induced Ulcerative Colitis by Inhibition of the TLR2/4/MyD88/NF-κB Signaling Pathway

Contact Info

Product

Resources

About