Cordycepin-hypersensitive growth links elevated polyphosphate levels to inhibition of poly(A) polymerase in Saccharomyces cerevisiae

Abstract

To identify genes involved in poly(A) metabolism, we screened the yeast gene deletion collection for growth defects in the presence of cordycepin (3′-deoxyadenosine), a precursor to the RNA chain terminating ATP analog cordycepin triphosphate. Δpho80 and Δpho85 strains, which have a constitutively active phosphate-response pathway, were identified as cordycepin hypersensitive. We show that inorganic polyphosphate (poly P) accumulated in these strains and that poly P is a potent inhibitor of poly(A) polymerase activity in vitro. Binding analyses of poly P and yeast Pap1p revealed an interaction with a kD in the low nanomolar range. Poly P also bound mammalian poly(A) polymerase, however, with a 10-fold higher kD compared to yeast Pap1p. Genetic tests with double mutants of Δpho80 and other genes involved in phosphate homeostasis and poly P accumulation suggest that poly P contributed to cordycepin hypersensitivity. Synergistic inhibition of mRNA synthesis through poly P-mediated inhibition of Pap1p and through cordycepin-mediated RNA chain termination may thus account for hypersensitive growth of Δpho80 and Δpho85 strains in the presence of the chain terminator. Consistent with this, a mutation in the 3′-end formation component rna14 was synthetic lethal in combination with Δpho80. Based on these observations, we suggest that binding of poly P to poly(A) polymerase negatively regulates its activity.

Cordycepin interferes with 3′ end formation in yeast independently of its potential to terminate RNA chain elongation

“…Somewhat curiously, Dpho85 and Dpho80 RNAs did not give any poly(A) labeling (Gel II). We recently showed that polyphosphate levels were elevated in these mutants, resulting in the inhibition of the in vitro labeling reaction and pointing to a possible role for this metabolite in regulating poly(A) polymerase (Holbein et al 2008). Short poly(A) tails were stabilized, for example, in the Dxrn1 strain, that lacks 59-39 exonuclease activity required for cytoplasmic mRNA turn-over (Gel III).…”

“…RNA extractions were done with a hot-phenol method as previously described (Holbein et al 2008). Northern blot analysis was done with RNAs resolved either on 1.2% denaturing formaldeyde/ agarose gels or with high-resolution 6% polyacrylamide/8.3 M urea gels (Dichtl et al 2002b).…”

“…18S rRNA (ACGAAAAATCAA ATAC), U3 snoRNA (AGGACATTTCTATAGGAATCG), and tRNA LEU 3 (GAACTCTTGCATCTTACGATAGC) were detected with 59 end labeled oligonucleotides. RNase H analyses (Dichtl et al 2002b) and poly(A) tail labeling (Holbein et al 2008) were done as previously described. Northern filters and dried gels were exposed to BAS-MS imaging plates (Fuji) and developed on a FLA-7000 PhosphorImager (Fuji).…”

Myeloma cells contain high levels of inorganic polyphosphate which is associated with nucleolar transcription

“…48 In yeast, polyP interacts and inhibits poly(A) polymerase activities. 49,50 Therefore, new roles for intracellular polyP in regulating gene expression in MC, and in other mammalian cells, could emerge when these studies are taken further.…”

A Soluble Pyrophosphatase Is Essential to Oogenesis and Is Required for Polyphosphate Metabolism in the Red Flour Beetle (Tribolium castaneum)

“…In nuclei, for microorganisms, it has been reported that poly P control gene expression [ 11 ] is a potent inhibitor of the degradosome-dependent degradation of mRNA [ 12 ] and a promoter of ribosomal [ 13 ] and nucleoid protein degradation by activating Lon protease [ 14 ]; It also assists in the fidelity of protein translation by its interaction with ribosomes [ 15 ]. In yeast, poly P interact and inhibit poly(A) polymerase activities [ 16 , 17 ]. In mammalian cells, poly P accumulates and regulates myeloma proliferation [ 18 ].…”