Cost‐effectiveness of longitudinal surveillance for Piscirickettsia salmonis using qPCR in Atlantic salmon farms (Salmo salar) in Chile

Abstract

Costs of diagnostic testing including sample collection, sampling frequency and sample size are an important consideration in the evaluation of the economic feasibility of alternative surveillance strategies for detection of infectious diseases in aquatic animals. In Chile, Piscirickettsia salmonis is the primary reason for antibiotic treatments in farmed Atlantic salmon. In 2012, a surveillance and control programme for piscirickettsiosis was established with an overall goal of reducing antibiotic use. The present study estimated the cost‐effectiveness of different sampling frequencies and sample sizes to achieve at least 95% confidence of early detection of P. salmonis at the netpen and farm levels using a validated qPCR test. We developed a stochastic model that incorporated variability in test accuracy, within‐pen prevalence and sampling costs. Our findings indicated that the current piscirickettsiosis surveillance programme based on risk‐based sampling of five moribund or dead fish from 2 to 3 netpens is cost‐effective and gives a high probability of detection of P. salmonis in Atlantic salmon farms in Chile at both the netpen and farm levels. Results from this study should incentivize salmon farmers to establish cost‐effective strategies for early detection of P. salmonis infection and the application of this approach to other highly infectious diseases.

Co-Infection by LF-89-Like and EM-90-Like Genogroups of Piscirickettsia Salmonis in Farmed Atlantic Salmon in Chile: Implications for Surveillance and Control of Piscirickettsiosis

“…Timely diagnosis and training in necropsies are fundamental aspects to reduce the incidence rate and severity of SRS and to optimize control of the disease [ 33 ]. The current SRS surveillance program is based on risk-based sampling [ 34 ] of five moribund or dead fish from two to three netpens, is cost-effective, and gives a high probability of detection of P. salmonis in Atlantic salmon farms in Chile at both the netpen and farm levels [ 27 ]. In addition, qPCR is fit for the purpose of presumptive diagnosis and surveillance for the detection of P. salmonis cases in endemically infected regions of Chile [ 28 ].…”

“…P. salmonis was detected using Taqman ® -based (Applied Biosystems, Life Technologies, Waltham, MA, USA) qPCR, as previously described by Karatas et al [ 26 ], using primers that bind to the 16S rRNA gene (F: AGGGAGACTGCCGGTGATA; R: ACTACGAGGCGCTTTCTCA; Probe: TGGGGCGTACAGACGGAGGC; Efficiency: 2.05; R 2 : 0.9999). These primers have previously been used in both field [ 27 , 28 ] and experimental (16–19) conditions. Hereafter, we will refer to this assay as “universal” P. salmonis qPCR.…”