covR Mediated Antibiofilm Activity of 3-Furancarboxaldehyde Increases the Virulence of Group A Streptococcus

Ganapathy, Ashwinkumar Subramenium; Viszwapriya, Dharmaprakash; Iyer, Prasanth Mani; Balamurugan, Krishnaswamy; Pandian, Shunmugiah Karutha

doi:10.1371/journal.pone.0127210

Cited by 29 publications

(13 citation statements)

References 53 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The cell suspensions were mixed gently with healthy human blood at a ratio of 1:4 and incubated at 37°C for 1 h. After incubation, the samples were serially diluted and spread over TSB agar plate. The plates were incubated for 24 h at 37°C and colonies were manually counted to identify the sensitivity of cells to healthy human blood (Subramenium et al, 2015).…”

Section: Methodsmentioning

confidence: 99%

Myrtenol Attenuates MRSA Biofilm and Virulence by Suppressing sarA Expression Dynamism

et al. 2019

View full text Add to dashboard Cite

Methicillin-resistant Staphylococcus aureus (MRSA) is a deleterious human pathogen responsible for severe morbidity and mortality worldwide. The pathogen has attained high priority in the World Health Organization (WHO) – Multidrug-resistant (MDR) pathogens list. Emerging MDR strains of S. aureus are clinically challenging due to failure in conventional antibiotic therapy. Biofilm formation is one of the underlying mechanisms behind the antibiotic resistance. Hence, attenuating biofilm formation has become an alternative strategy to control persistent infections. The current study is probably the first that focuses on the antibiofilm and antivirulence potential of myrtenol against MRSA and its clinical isolates. Myrtenol exhibited a concentration-dependent biofilm inhibition without causing any harmful effect on cell growth and viability. Further, microscopic analysis validated the biofilm inhibitory efficacy of myrtenol against MRSA. In addition, myrtenol inhibited the synthesis of major virulence factors including slime, lipase, α-hemolysin, staphyloxanthin and autolysin. Inhibition of staphyloxanthin in turn sensitized the MRSA cells to healthy human blood and hydrogen peroxide (H2O2). Notably, myrtenol treated cells were deficient in extracellular DNA (eDNA) mediated autoaggregation as eDNA releasing autolysis was impaired by myrtenol. Biofilm disruptive activity on preformed biofilms was observed at concentrations higher than minimum biofilm inhibitory concentration (MBIC) of myrtenol. Also, the non-cytotoxic effect of myrtenol on human peripheral blood mononuclear cell (PBMC) was evidenced by trypan blue and Alamar blue assays. Transcriptional analysis unveiled the down-regulation of global regulator sarA and sarA mediated virulence genes upon myrtenol treatment, which is well correlated with results of phenotypic assays. Thus, the results of the present study revealed the sarA mediated antibiofilm and antivirulence potential of myrtenol against MRSA.

show abstract

Section: Methodsmentioning

confidence: 99%

Myrtenol Attenuates MRSA Biofilm and Virulence by Suppressing sarA Expression Dynamism

et al. 2019

View full text Add to dashboard Cite

show abstract

“…Reverse transcriptase quantitative PCR (RT-qPCR) was performed using a 2× SYBR FAST qPCR universal MasterMix kit (Kappa Biosystems, USA). Gyrase A ( gyrA ) was used as an endogenous control (44). The following primers were used (5′ to 3′): hasA , (forward) AGGACGCACTGTCTACCAATC and (reverse) GTCCATAAGGCAACGATGGGA; gyrA , (forward) CAACGCACGTAAGGAAGAAA and (reverse) CGCTTGTCAAAACGACGTTA.…”

Section: Methodsmentioning

confidence: 99%

Streptococcus pyogenes Capsule Promotes Microcolony-Independent Biofilm Formation

Matysik

Kline

2019

J Bacteriol

View full text Add to dashboard Cite

Biofilms play an important role in the pathogenesis of group A streptococcus (GAS), a Gram-positive pathogen responsible for a wide range of infections and with a significant public health impact. Although most GAS serotypes are able to form biofilms, there is a large amount of heterogeneity between individual strains in biofilm formation, as measured by standard crystal violet assays. It is generally accepted that biofilm formation includes the initial adhesion of bacterial cells to a surface followed by microcolony formation, biofilm maturation, and extensive production of extracellular matrix that links together proliferating cells and provides a scaffold for the three-dimensional (3D) biofilm structure. However, our studies show that for GAS strain JS95, microcolony formation is not an essential step in static biofilm formation, and instead, biofilm can be effectively formed from slow-growing or nonreplicating late-exponential- or early-stationary-phase planktonic cells via sedimentation and fixation of GAS chains. In addition, we show that the GAS capsule specifically contributes to the alternative sedimentation-initiated biofilms. Microcolony-independent sedimentation biofilms are similar in morphology and 3D structure to biofilms initiated by actively dividing planktonic bacteria. We conclude that GAS can form biofilms by an alternate noncanonical mechanism that does not require transition from microcolony formation to biofilm maturation and which may be obscured by biofilm phenotypes that arise via the classical biofilm maturation processes. IMPORTANCE The static biofilm assay is a common tool for easy biomass quantification of biofilm-forming bacteria. However, Streptococcus pyogenes biofilm formation as measured by the static assay is strain dependent and yields heterogeneous results for different strains of the same serotype. In this study, we show that two independent mechanisms, for which the protective capsule contributes opposing functions, may contribute to static biofilm formation. We propose that separation of these mechanisms for biofilm formation might uncover previously unappreciated biofilm phenotypes that may otherwise be masked in the classic static assay.

show abstract

“…RT-qPCR was performed using 2xSYBR FAST qPCR universal MasterMix kit (Kappa Biosystems, USA). Gyrase A ( gyrA ) was used as an endogenous control [44]. The following primers were used (5’ > 3’): hasA: (FWD) AGGACGCACTGTCTACCAATC; (REV) GTCCATAAGGCAACGATGGGA; gyrA: (FWD) CAACGCACGTAAGGAAGAAA; (REV) CGCTTGTCAAAACGACGTTA.…”

Section: Methodsmentioning

confidence: 99%

Streptococcus pyogenescapsule promotes microcolony-independent biofilm formation

Matysik

Kline

2019

Preprint

View full text Add to dashboard Cite

Biofilms play an important role in the pathogenesis of Group A Streptococcus (GAS), a gram-positive pathogen responsible for a wide range infections and significant public health impact. Although most GAS serotypes are able to form biofilms, there is large heterogeneity between individual strains in biofilm formation, as measured by standard crystal violet assays. It is generally accepted that biofilm formation includes initial adhesion of bacterial cells to a surface, followed by microcolony formation, biofilm maturation, and extensive production of extracellular matrix that links together proliferating cells and provides a scaffold for the three-dimensional biofilm structure. However, our studies show that for GAS strain JS95, microcolony formation is not an essential step in static biofilm formation, and instead, biofilm can be effectively formed from slow-growing or non-replicating late exponential or early stationary planktonic cells, via sedimentation and fixation of GAS chains into biofilms. In addition, we show that the GAS capsule specifically contributes to the alternative, sedimentation-initiated biofilms. Microcolony-independent, sedimentation biofilms are similar in morphology and 3-D structure to biofilms initiated by actively dividing planktonic bacteria. We conclude that GAS can form biofilms by an alternate, non-canonical mechanism that does not require transition from microcolony formation to biofilm maturation, and which may be obscured by biofilm phenotypes that arise via the classical biofilm maturation processes.IMPORTANCEThe static biofilm assay is a common tool for easy biomass quantification of biofilm forming bacteria. However,S. pyogenesbiofilm formation as measured by the static assay is strain dependent and yields heterogeneous results for different strains of the same serotype. In this study, we show that two independent mechanisms, for which the protective capsule contributes opposing functions, may contribute to static biofilm formation. We propose that separation of these mechanisms for biofilm formation might uncover previously unappreciated biofilm phenotypes that may otherwise be masked in the classic static assay.

show abstract

covR Mediated Antibiofilm Activity of 3-Furancarboxaldehyde Increases the Virulence of Group A Streptococcus

Cited by 29 publications

References 53 publications

Myrtenol Attenuates MRSA Biofilm and Virulence by Suppressing sarA Expression Dynamism

Myrtenol Attenuates MRSA Biofilm and Virulence by Suppressing sarA Expression Dynamism

Streptococcus pyogenes Capsule Promotes Microcolony-Independent Biofilm Formation

Streptococcus pyogenescapsule promotes microcolony-independent biofilm formation

Contact Info

Product

Resources

About