Creating Recombination‐Activated Genes and Sequence‐Defined Mutant Libraries Using Transposons

Gallagher, Larry A.; Turner, Cheri; Ramage, Elizabeth; Manoil, Colin

doi:10.1016/s0076-6879(06)21012-7

Cited by 9 publications

(9 citation statements)

References 19 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Insertion sites were identified by semidegenerate PCR and sequencing of the transposon-genome junctions (37, 50) (see Text S1 in the supplemental material).…”

Section: Methodsmentioning

confidence: 99%

Sequence-Defined Transposon Mutant Library of Burkholderia thailandensis

Gallagher

Ramage

Patrapuvich

et al. 2013

mBio

Self Cite

View full text Add to dashboard Cite

We constructed a near-saturation transposon mutant library for Burkholderia thailandensis, a low-virulence surrogate for the causative agent of melioidosis (Burkholderia pseudomallei). A primary set of nearly 42,000 unique mutants (~7.5 mutants/gene) was generated using transposon Tn5 derivatives. The strains carry insertions in 87% of the predicted protein-coding genes of the organism, corresponding to nearly all of those nonessential for growth on nutrient agar. To achieve high genome coverage, we developed procedures for efficient sequence identification of insertions in extremely GC-rich regions of DNA. To facilitate strain distribution, we created a secondary library with two mutants per gene for which most transposon locations had been confirmed by resequencing. A map of mutations in the two-allele library and procedures for obtaining strains can be found at and . The library should facilitate comprehensive mutant screens and serve as a source of strains to test predicted genotype-phenotype associations.

show abstract

“…Insertion sites were identified by semidegenerate PCR and sequencing of the transposon-genome junctions (37, 50) (see Text S1 in the supplemental material).…”

Section: Methodsmentioning

confidence: 99%

Sequence-Defined Transposon Mutant Library of Burkholderia thailandensis

Gallagher

Ramage

Patrapuvich

et al. 2013

mBio

Self Cite

View full text Add to dashboard Cite

show abstract

“…Insertion sites were identified by semidegenerate PCR and sequencing of the transposon-genome junctions (52,53). Specific protocols and oligonucleotide sequences used are available upon request.…”

mentioning

confidence: 99%

Resources for Genetic and Genomic Analysis of Emerging Pathogen Acinetobacter baumannii

et al. 2015

Self Cite

View full text Add to dashboard Cite

Acinetobacter baumannii is a Gram-negative bacterial pathogen notorious for causing serious nosocomial infections that resist antibiotic therapy. Research to identify factors responsible for the pathogen's success has been limited by the resources available for genome-scale experimental studies. This report describes the development of several such resources for A. baumannii strain AB5075, a recently characterized wound isolate that is multidrug resistant and displays robust virulence in animal models. We report the completion and annotation of the genome sequence, the construction of a comprehensive ordered transposon mutant library, the extension of high-coverage transposon mutant pool sequencing (Tn-seq) to the strain, and the identification of the genes essential for growth on nutrient-rich agar. These resources should facilitate large-scale genetic analysis of virulence, resistance, and other clinically relevant traits that make A. baumannii a formidable public health threat. IMPORTANCEAcinetobacter baumannii is one of six bacterial pathogens primarily responsible for antibiotic-resistant infections that have become the scourge of health care facilities worldwide. Eliminating such infections requires a deeper understanding of the factors that enable the pathogen to persist in hospital environments, establish infections, and resist antibiotics. We present a set of resources that should accelerate genome-scale genetic characterization of these traits for a reference isolate of A. baumannii that is highly virulent and representative of current outbreak strains.A cinetobacter baumannii is a Gram-negative opportunistic pathogen that causes infections with serious morbidity and mortality and is one of a group of six pathogens responsible for most multidrug-resistant (MDR) nosocomial infections (the ESKAPE pathogens, i.e., Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter species) (1, 2). The pathogen is infamous for its ability to persist in hospital settings, a feature that reflects its capacity for long-term survival on abiotic surfaces through resistance to desiccation and disinfectants (3).Genomic and molecular epidemiological studies of A. baumannii isolates have helped define the pathogen's global population structure, its antibiotic resistance gene repertoire, the size and content of its pangenome, and phylogenetic relationships among outbreak strains (3-6). Three primary clonal lineages (GC1 to GC3) appear responsible for the majority of hospital outbreaks globally (7). Although these lineages display restricted genetic diversity among core genes (7), the species' genome is actually quite dynamic. Strains display striking variability in accessory gene content (5, 8), including antibiotic resistance genes (9), even among related isolates of a single outbreak (10). This genomic variability presumably reflects the actions of transmissible plasmids, insertion elements, phage, integrons, natural transformation, and reco...

show abstract

“…We found that 98.5% transformants were free of the delivery plasmid backbone among 2200 transposon‐insertion mutants analysed. We adapted an efficient, semirandom, PCR‐based high‐throughput method (Gallagher et al ., 2007; Cameron et al ., 2008) for identifying and verifying transposon insertion sites with an average success rate of 89% among 337 mutants sequenced. The primer sequences can be obtained upon request.…”

Section: Methodsmentioning

confidence: 99%

“…To prepare DNA samples from papillation mutants, 10 µl of the supernatant was collected from a small amount of cells after boiling for 10 min in 20 µl of water by centrifugation. A DNA fragment containing the nprR gene was amplified and sequenced using previously published protocols (PCR round 2/cleanup/sequencing; Gallagher et al ., 2007). The PCR primers are BAS0566A 5′‐AGCGGCGATTGTGAATACC‐3′ (300 bp immediately upstream of nprR ) and BAS0566B 5′‐GAGCACATTTTTAGAATCTGCA‐3′ (400 bp immediately downstream of nprR ).…”

Section: Methodsmentioning

confidence: 99%

Papillation in Bacillus anthracis colonies: a tool for finding new mutators

Yang¹,

Sikavi²,

Tran³

et al. 2011

Molecular Microbiology

View full text Add to dashboard Cite

SummaryColonies of Bacillus anthracis Sterne allow the growth of papillation after 6 days of incubation at 30°C on Luria-Bertani medium. The papillae are due to mutations that allow the cells to overcome the barriers to continued growth. Cells isolated from papillae display two distinct gross phenotypes (group A and group B). We determined that group A mutants have mutations in the nprR gene including frameshifts, deletions, duplications and base substitutions. We used papillation as a tool for finding new mutators as the mutators generate elevated levels of papillation. We discovered that disruption of yycJ or recJ leads to a spontaneous mutator phenotype. We defined the nprR/papillation system as a new mutational analysis system for B. anthracis. The mutational specificity of the new mutator yycJ is similar to that of mismatch repair-deficient strains (MMR -) such as those with mutations in mutL or mutS. Deficiency in recJ results in a unique specificity, generating only tandem duplications.

show abstract

Creating Recombination‐Activated Genes and Sequence‐Defined Mutant Libraries Using Transposons

Cited by 9 publications

References 19 publications

Sequence-Defined Transposon Mutant Library of Burkholderia thailandensis

Sequence-Defined Transposon Mutant Library of Burkholderia thailandensis

Resources for Genetic and Genomic Analysis of Emerging Pathogen Acinetobacter baumannii

Papillation in Bacillus anthracis colonies: a tool for finding new mutators

Contact Info

Product

Resources

About