Critical role of TRPC1 in thyroid hormone-dependent dopaminergic neuron development

Chen, Chunhai; Ma, Qinglong; Deng, Ping; Yang, Jianjing; Yang, Lingling; Lin, Min; Yu, Zhengping; Zhou, Zhou

doi:10.1016/j.bbamcr.2017.07.019

Cited by 14 publications

(7 citation statements)

References 51 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…TRPC1 is consistently associated with store-operated calcium (Ca 2+ ) entry (SOCE), an important regulatory mechanism for Ca 2+ homeostasis, which is closely related to neuronal development and differentiation (Inglefield et al, 2001 ; Wu et al, 2004 ). Ca 2+ signaling is of vital importance for multiple physiological processes, including neuronal development/differentiation/maturation, neurosecretion and exocytosis (Bollimuntha et al, 2017 ; Chen et al, 2017 ).…”

Section: Discussionmentioning

confidence: 99%

TRPC1 Deletion Causes Striatal Neuronal Cell Apoptosis and Proteomic Alterations in Mice

Wang

et al. 2018

Front. Aging Neurosci.

View full text Add to dashboard Cite

Transient receptor potential channel 1 (TRPC1) is widely expressed throughout the nervous system, while its biological role remains unclear. In this study, we showed that TRPC1 deletion caused striatal neuronal loss and significantly increased TUNEL-positive and 8-hydroxy-2′-deoxyguanosine (8-OHdG) staining in the striatum. Proteomic analysis by two-dimensional fluorescence difference gel electrophoresis (2D-DIGE) coupled with mass spectrometry (MS) revealed a total of 51 differentially expressed proteins (26 increased and 25 decreased) in the stratum of TRPC1 knockout (TRPC1−/−) mice compared to that of wild type (WT) mice. Bioinformatics analysis showed these dysregulated proteins included: oxidative stress-related proteins, synaptic proteins, endoplasmic reticulum (ER) stress-related proteins and apoptosis-related proteins. STRING analysis showed these differential proteins have a well-established interaction network. Based on the proteomic data, we revealed by Western-blot analysis that TRPC1 deletion caused ER stress as evidenced by the dysregulation of GRP78 and PERK activation-related signaling pathway, and elevated oxidative stress as suggested by increased 8-OHdG staining, increased NADH dehydrogenase (ubiquinone) flavoprotein 2 (NDUV2) and decreased protein deglycase (DJ-1), two oxidative stress-related proteins. In addition, we also demonstrated that TRPC1 deletion led to significantly increased apoptosis in striatum with concurrent decrease in both 14–3–3Z and dynamin-1 (D2 dopamine (DA) receptor binding), two apoptosis-related proteins. Taken together, we concluded that TRPC1 deletion might cause striatal neuronal apoptosis by disturbing multiple biological processes (i.e., ER stress, oxidative stress and apoptosis-related signaling). These data suggest that TRPC1 may be a key player in the regulation of striatal cellular survival and death.

show abstract

Section: Discussionmentioning

confidence: 99%

TRPC1 Deletion Causes Striatal Neuronal Cell Apoptosis and Proteomic Alterations in Mice

Wang

et al. 2018

Front. Aging Neurosci.

View full text Add to dashboard Cite

show abstract

“…Real-time PCR was performed and quantified as we previously described (Livak and Schmittgen, 2001;Chen et al, 2017). The following primers were used: Epha4 fwd tcgtttctctttggaatttgcg and rev ataatgctcacttcctcccac, Epha5 fwd ggacgtgccttctcttgtg and rev cttcaccaatctcttcccacc, Epha7 fwd agaaggagagtggctagtacc and rev ggacaacgagaacactggag, Epha8 fwd gcgaagtgaacttgttggatac and rev tgcatacttggtacgtgtgg, Ephb1 fwd cgatggaagagacattgatggac and rev ggtaagtacggatggtgttcag, Ephb3 fwd actctcatggacacgaaatgg and rev tcgactcacgcacattacac, and Ephb4 fwd gatcgcattcagccaaagtg and rev aagtcacccatttcagatccg.…”

Section: Real-time Pcrmentioning

confidence: 99%

1800 MHz Radiofrequency Electromagnetic Field Impairs Neurite Outgrowth Through Inhibiting EPHA5 Signaling

Chen

Deng

et al. 2021

Front. Cell Dev. Biol.

Self Cite

View full text Add to dashboard Cite

The increasing intensity of environmental radiofrequency electromagnetic fields (RF-EMF) has increased public concern about its health effects. Of particular concern are the influences of RF-EMF exposure on the development of the brain. The mechanisms of how RF-EMF acts on the developing brain are not fully understood. Here, based on high-throughput RNA sequencing techniques, we revealed that transcripts related to neurite development were significantly influenced by 1800 MHz RF-EMF exposure during neuronal differentiation. Exposure to RF-EMF remarkably decreased the total length of neurite and the number of branch points in neural stem cells-derived neurons and retinoic acid-induced Neuro-2A cells. The expression of Eph receptors 5 (EPHA5), which is required for neurite outgrowth, was inhibited remarkably after RF-EMF exposure. Enhancing EPHA5 signaling rescued the inhibitory effects of RF-EMF on neurite outgrowth. Besides, we identified that cAMP-response element-binding protein (CREB) and RhoA were critical downstream factors of EPHA5 signaling in mediating the inhibitory effects of RF-EMF on neurite outgrowth. Together, our finding revealed that RF-EMF exposure impaired neurite outgrowth through EPHA5 signaling. This finding explored the effects and key mechanisms of how RF-EMF exposure impaired neurite outgrowth and also provided a new clue to understanding the influences of RF-EMF on brain development.

show abstract

“…In addition, thyroid hormone increases TRPC1 expression through its receptor alpha 1 during DA neuron differentiation. Although his research can generate calcium signals by activating TRPC1 channels, it does not explain the role of DA neurons [ 5 ].…”

Section: Introductionmentioning

confidence: 99%

Mechanism of Dopaminergic Nerve Transmission in Different Doses of Morphine Addiction and Stress-Induced Depression

2021

Journal of Healthcare Engineering

View full text Add to dashboard Cite

Depression not only threatens the health and quality of life of patients but also brings a huge mental and economic burden to the patients’ families. This paper mainly studies the mechanism of dopaminergic neurotransmission in different doses of morphine addiction and stress-induced depression. In the experiment, 40 male SD rats were selected. The experiment established a rat model of chronic stress depression. The rats used in this model are all raised in a single cage, and there will be various stimuli every day for 21 days, but high-intensity continuous stimuli must be avoided, and the same stimuli will not appear continuously. The experiment established a depression animal model through chronic unpredictable mild stress (CUMS), combined with the conditioned position preference (CPP) model of morphine addiction to detect the establishment of CPP in such animals, so as to explore certain stress stimuli or depression, the influence on morphine addiction, and the relationship between them. The second or third branches of pyramidal neurons were selected to analyze the PL and CA3 regions. When analyzing the density of dendrites, each animal selected at least 8 dendrites in order to count the number of dendrites and selected a length of 20 μm on each branch to record the number of dendrites. All measured values are expressed as average ± standard deviation and analyzed by SPSS17.0 statistical software, and Levene test is used in the scattered consistency test. The average NIV of PEN before injection was 11.92 ± 2.90 Hz, and the average latency was 0.16 ± 0.03 s. The results indicate that CUMS may reduce the conditioned learning and memory ability by damaging the learning loop, rather than affecting the reward loop to weaken the establishment of morphine-dependent CPP.

show abstract

Critical role of TRPC1 in thyroid hormone-dependent dopaminergic neuron development

Cited by 14 publications

References 51 publications

TRPC1 Deletion Causes Striatal Neuronal Cell Apoptosis and Proteomic Alterations in Mice

TRPC1 Deletion Causes Striatal Neuronal Cell Apoptosis and Proteomic Alterations in Mice

1800 MHz Radiofrequency Electromagnetic Field Impairs Neurite Outgrowth Through Inhibiting EPHA5 Signaling

Mechanism of Dopaminergic Nerve Transmission in Different Doses of Morphine Addiction and Stress-Induced Depression

Contact Info

Product

Resources

About