Critical Role of Tumor Necrosis Factor-α and NF-κB in Interferon-γ-induced CD40 Expression in Microglia/Macrophages

Nguyen, Vince T.; Benveniste, Etty N.

doi:10.1074/jbc.m111906200

Cited by 105 publications

(113 citation statements)

References 39 publications

Supporting

Mentioning

108

Contrasting

Unclassified

Order By: Relevance

“…We have recently shown that both IFN-␥ and TNF-␣ are required for CD40 gene expression in macrophages and microglia (26). FACS analysis demonstrated that IFN-␥ increases CD40 protein expression on the cell surface, as measured by mean fluorescence intensity (Fig.…”

Section: Tnf-␣ Is Required For Ifn-␥ Induction Of Cd40 But Alone Doementioning

confidence: 85%

“…1A). We have previously demonstrated that IFN-␥ induction of CD40 in these cells requires both STAT-1␣ and NF-B activation (25,26). TNF-␣ is a well-known activator of NF-B and does so in the RAW264.7 cells (data not shown).…”

Section: Tnf-␣ Is Required For Ifn-␥ Induction Of Cd40 But Alone Doementioning

confidence: 90%

“…Bound and free DNA were then resolved by electrophoresis through a 6% polyacrylamide gel in 0.5ϫ Tris-borate-EDTA buffer at 250 V for 1 h. For supershift analysis, 1 g of indicated Ab was added, or for competition analysis, a 100-fold molar excess of the indicated cold oligonucleotide was added to the nuclear extracts and incubated on ice for 30 min, followed by an additional incubation for 15 min with the labeled probe. The oligonucleotide sequences used as probes include the distal NF-B element (CGAGGGAATTTCCTTTGAA) and the medial GAS element (GGAAACTCTTCCTTGAAACGCCTCC) from the human CD40 promoter (26).…”

Section: Nuclear Extracts and Emsamentioning

confidence: 99%

“…In addition to the activation of STAT-1␣, which binds to IFN-␥ activation site (GAS) elements within the CD40 promoter, IFN-␥ induces the secretion and subsequent autocrine and/or paracrine signaling of TNF-␣ (26). The importance of TNF-␣ in IFN-␥-mediated CD40 expression is demonstrated by the observation that IFN-␥ induction of CD40 expression is attenuated in the presence of a neutralizing anti-TNF-␣ Ab (26). Moreover, we have demonstrated that there are critical B elements within the CD40 promoter (26).…”

mentioning

confidence: 99%

“…The importance of TNF-␣ in IFN-␥-mediated CD40 expression is demonstrated by the observation that IFN-␥ induction of CD40 expression is attenuated in the presence of a neutralizing anti-TNF-␣ Ab (26). Moreover, we have demonstrated that there are critical B elements within the CD40 promoter (26). However, although TNF-␣ is a necessary component of IFN-␥-induced CD40 up-regulation, TNF-␣ treatment in and of itself does not induce CD40 expression in macrophages/microglia (24).…”

mentioning

confidence: 99%

See 4 more Smart Citations

Suppressor of Cytokine Signaling 1 Inhibits Cytokine Induction of CD40 Expression in Macrophages

Wesemann

Dong

O'Keefe

et al. 2002

The Journal of Immunology

Self Cite

View full text Add to dashboard Cite

CD40 is a type I membrane-bound molecule belonging to the TNFR superfamily that is expressed on various immune cells including macrophages and microglia. The aberrant expression of CD40 is involved in the initiation and maintenance of various human diseases including multiple sclerosis, arthritis, atherosclerosis, and Alzheimer’s disease. Inhibition of CD40 signaling has been shown to provide a significant beneficial effect in a number of animal models of human diseases including the aforementioned examples. We have previously shown that IFN-γ induces CD40 expression in macrophages and microglia. IFN-γ leads to STAT-1α activation directly and up-regulation of NF-κB activity due to the secretion and subsequent autocrine signaling of TNF-α. However, TNF-α alone is not capable of inducing CD40 expression in these cells. Suppressor of cytokine signaling 1 protein (SOCS-1) is a cytokine-inducible Src homology 2-containing protein that regulates cytokine receptor signaling by inhibiting STAT-1α activation via a specific interaction with activated Janus kinase 2. Given the important role of CD40 in inflammatory events in the CNS as well as other organ systems, it is imperative to understand the molecular mechanisms contributing to both CD40 induction and repression. We show that ectopic expression of SOCS-1 abrogates IFN-γ-induced CD40 protein expression, mRNA levels, and promoter activity. Additionally, IFN-γ-induced TNF-α secretion, as well as STAT-1α and NF-κB activation, are inhibited in the presence of SOCS-1. We conclude that SOCS-1 inhibits cytokine-induced CD40 expression by blocking IFN-γ-mediated STAT-1α activation, which also then results in suppression of IFN-γ-induced TNF-α secretion and subsequent NF-κB activation.

show abstract

Section: Tnf-␣ Is Required For Ifn-␥ Induction Of Cd40 But Alone Doementioning

confidence: 85%

Section: Tnf-␣ Is Required For Ifn-␥ Induction Of Cd40 But Alone Doementioning

confidence: 90%

Section: Nuclear Extracts and Emsamentioning

confidence: 99%

mentioning

confidence: 99%

mentioning

confidence: 99%

See 3 more Smart Citations

Suppressor of Cytokine Signaling 1 Inhibits Cytokine Induction of CD40 Expression in Macrophages

Wesemann

Dong

O'Keefe

et al. 2002

The Journal of Immunology

Self Cite

View full text Add to dashboard Cite

show abstract

Therapeutic Monoclonal Antibodies and Their Targets

Figueroa

Peña

Mirandola

et al. 2016

Biosimilars of Monoclonal Antibodies

View full text Add to dashboard Cite

The underestimated potential of the immune system in prevention of Alzheimer's disease pathology

Mohajeri

2007

BioEssays

View full text Add to dashboard Cite

Genetic and environmental factors leading to Alzheimer's disease (AD) converge in a pathogenic pathway that leads to the accumulation of mis-folded amyloid peptide (Abeta) in the brain. Removal of Abeta from the brain has thus been the focus of academic and industrial research in the last decade. The concept of immunization therapy could be proven in animal models mimicking amyloid pathology but a multicenter clinical trial in which AD patients were vaccinated with aggregated Abeta has resulted in somewhat unanticipated and partially conflicting results. The occurrence of meningoencephalitis in 6% of vaccinated individuals forced the discontinuation of the clinical study, preventing the generation of sufficient data for an unequivocal statement about the effectiveness of such a therapy approach. This study, however, clearly showed that vaccination induced the production of antibodies against Abeta in some immunized patients. Moreover, circulating anti-Abeta antibodies are found in healthy humans suggesting a protective role of such physiological antibodies. Nonetheless, the physiological role of the immune system in preventing AD is not fully understood. This article summarizes crucial animal and clinical data underscoring the potential of the immune system for AD treatment.

show abstract

Critical Role of Tumor Necrosis Factor-α and NF-κB in Interferon-γ-induced CD40 Expression in Microglia/Macrophages

Cited by 105 publications

References 39 publications

Suppressor of Cytokine Signaling 1 Inhibits Cytokine Induction of CD40 Expression in Macrophages

Suppressor of Cytokine Signaling 1 Inhibits Cytokine Induction of CD40 Expression in Macrophages

Therapeutic Monoclonal Antibodies and Their Targets

The underestimated potential of the immune system in prevention of Alzheimer's disease pathology

Contact Info

Product

Resources

About