Cryo-EM structure of the Plasmodium falciparum 80S ribosome bound to the anti-protozoan drug emetine

Wong, Wilson; Bai, Xiao Chen; Brown, Alan; Fernandez, I.S.; Hanssen, Eric; Condron, Melanie; Tan, Yan; Baum, Jake; Scheres, Sjors H.W.

doi:10.7554/elife.03080

Cited by 324 publications

(401 citation statements)

References 54 publications

Supporting

Mentioning

386

Contrasting

Unclassified

Order By: Relevance

“…5A). Overall, our study also demonstrates that cryo-EM can be used to determine de novo the binding site of antibiotics on the bacterial ribosome, as was also recently demonstrated for the antiprotozoan drug emetine in complex with the Plasmodium falciparum 80S ribosome (43).…”

Section: Resultssupporting

confidence: 78%

Structures of the orthosomycin antibiotics avilamycin and evernimicin in complex with the bacterial 70S ribosome

Arenz¹,

Juette

Graf³

et al. 2016

Proc. Natl. Acad. Sci. U.S.A.

View full text Add to dashboard Cite

The ribosome is one of the major targets for therapeutic antibiotics; however, the rise in multidrug resistance is a growing threat to the utility of our current arsenal. The orthosomycin antibiotics evernimicin (EVN) and avilamycin (AVI) target the ribosome and do not display cross-resistance with any other classes of antibiotics, suggesting that they bind to a unique site on the ribosome and may therefore represent an avenue for development of new antimicrobial agents. Here we present cryo-EM structures of EVN and AVI in complex with the Escherichia coli ribosome at 3.6- to 3.9-Å resolution. The structures reveal that EVN and AVI bind to a single site on the large subunit that is distinct from other known antibiotic binding sites on the ribosome. Both antibiotics adopt an extended conformation spanning the minor grooves of helices 89 and 91 of the 23S rRNA and interacting with arginine residues of ribosomal protein L16. This binding site overlaps with the elbow region of A-site bound tRNA. Consistent with this finding, single-molecule FRET (smFRET) experiments show that both antibiotics interfere with late steps in the accommodation process, wherein aminoacyl-tRNA enters the peptidyltransferase center of the large ribosomal subunit. These data provide a structural and mechanistic rationale for how these antibiotics inhibit the elongation phase of protein synthesis.

show abstract

Section: Resultssupporting

confidence: 78%

Structures of the orthosomycin antibiotics avilamycin and evernimicin in complex with the bacterial 70S ribosome

Arenz¹,

Juette

Graf³

et al. 2016

Proc. Natl. Acad. Sci. U.S.A.

View full text Add to dashboard Cite

show abstract

“…Prior to initiation, the mRNA (GGCAAGGAGGUAAAUAAUGUUCGUUACGAC; the AUG start codon coding for fMet and UUC coding for Phe are underlined) was incubated with 0.1 mM EDTA for 90 s at 80 uC and shock cooled in an ice-water bath. 70S ribosomes (3 mM) were incubated with IF1, IF2, IF3 (4.5 mM), mRNA (15 mM), and f[ 3 H]Met-tRNA fMet (7 mM) in buffer A (50 mM Tris-HCl, pH 7.5, 70 mM NH 4 Cl, 30 mM KCl, 7 mM MgCl 2 ) containing 2 mM dithiothreitol (DTT) and 1 mM GTP for 30 min at 37 uC. Initiation efficiency was verified by nitrocellulose binding assay and radioactivity counting to be close to 100%.…”

Section: Methodsmentioning

confidence: 99%

“…The complexes were purified by size-exclusion chromatography on a Biosuite 450 HR 5 mm column (Waters) using HPLC Alliance system (Waters). The cognate ternary complex EF-Tu-GTP-Phe-tRNA Phe was prepared in buffer B (50 mM HEPES-KOH, pH 7.5, 70 mM NH 4 Cl, 30 mM KCl, 7 mM MgCl 2 , 2 mM DTT) using a twofold excess of EF-Tu over Phe-tRNA Phe . Initiation complexes (0.07 mM) were mixed with excess of deacylated tRNA fMet (0.2 mM) and ternary complexes (0.12 mM) in buffer C (50 mM HEPES-KOH, pH 7.5, 70 mM NH 4 Cl, 30 mM KCl, 20 mM MgCl 2 , 1 mM DTT, 0.6 mM spermine, 0.4 mM spermidine) in the presence of 150 mM kirromycin.…”

Section: Methodsmentioning

confidence: 99%

Structure of the E. coli ribosome–EF-Tu complex at <3 Å resolution by Cs-corrected cryo-EM

Fischer

Neumann

Konevega

et al. 2015

Nature

364

443

View full text Add to dashboard Cite

Single particle electron cryomicroscopy (cryo-EM) has recently made significant progress in high-resolution structure determination of macromolecular complexes due to improvements in electron microscopic instrumentation and computational image analysis. However, cryo-EM structures can be highly non-uniform in local resolution 1,2 and all structures available to date have been limited to resolutions above 3 Å 3,4 . Here we present the cryo-EM structure of the 70S ribosome from Escherichia coli in complex with elongation factor Tu, aminoacyl-tRNA and the antibiotic kirromycin at 2.65-2.9 Å resolution using spherical aberration (C s )-corrected cryo-EM. Overall, the cryo-EM reconstruction at 2.9 Å resolution is comparable to the best-resolved X-ray structure of the E. coli 70S ribosome 5 (2.8 Å ), but provides more detailed information (2.65 Å ) at the functionally important ribosomal core. The cryo-EM map elucidates for the first time the structure of all 35 rRNA modifications in the bacterial ribosome, explaining their roles in fine-tuning ribosome structure and function and modulating the action of antibiotics. We also obtained atomic models for flexible parts of the ribosome such as ribosomal proteins L9 and L31. The refined cryo-EM-based model presents the currently most complete high-resolution structure of the E. coli ribosome, which demonstrates the power of cryo-EM in structure determination of large and dynamic macromolecular complexes.Determining the structure of large, dynamic biological macromolecules at a uniformly high resolution provides a challenge both for X-ray crystallography and cryo-EM. Here we have used aberration-corrected cryo-EM in combination with extensive computational sorting to solve *These authors contributed equally to this work.

show abstract

“…Especially in this context, we can see the recent emergence of ribosome structures in multiple states with close-to-atomic resolution (e.g. [64][65][66][67][68]) as emblematic for the progress of the entire field.…”

mentioning

confidence: 99%

“…At once -but by virtue of basically the same concepts that took 30 years to develop -atomic structures have now come into view, and virtually overnight single-particle cryo-EM has become a serious competitor of X-ray crystallography (e.g. [64,65,67,68,80,81]). As spectacularly demonstrated by Yifan Cheng's group at UCSF, even the structures of small membrane channels can now be solved by singleparticle cryo-EM at close-to-atomic resolution [82,83].…”

mentioning

confidence: 99%

Generalized single-particle cryo-EM – a historical perspective

Frank

2015

Microscopy (Tokyo)

View full text Add to dashboard Cite

This is a brief account of the earlier history of single-particle cryo-EM of biological molecules lacking internal symmetry, which goes back to the mid-seventies. The emphasis of this review is on the mathematical concepts and computational approaches. It is written as the field experiences a turning point in the wake of the introduction of digital cameras capable of single electron counting, and near-atomic resolution can be reached even for smaller molecules.Key words: 3D reconstruction, image processing, ribosome, molecular structureThe spectacular, fast-paced advances in single-particle cryogenic electron microscopy (cryo-EM) in the past 3 years, following the introduction of novel direct detection device (DDD) cameras with superior signal-to-noise ratio and resolution [1,2], are currently the subject of many commentaries and news and views articles conveying the general excitement of the structural biology community and the scientific community at large. As someone who has been in the field since the early days, I would like to contribute by a recollection of how the field developed.Single-particle EM, as a novel approach to structural biology, required a heretical concept going against the grain of wisdom which held that quantitative structure determination by 3D reconstruction from EM projections [3] is not feasible unless molecules are arranged in crystalline order. These ordered structures include those with helical symmetry, as in DeRosier and Klug's reconstruction of a bacteriophage tail [3], arranged in a two-dimensional crystal [4,5], or with high symmetry as in viruses [6]. Viruses, although classifiable as single particles, contain structural information in a highly redundant form. For instance, the projection of a virus with icosahedral symmetry contains 60 projections of its asymmetric unit. Not only is the spatial arrangement of these units fixed and recoverable from the Fourier transform, but the signal is also retrieved with an instant bonus of nearly 8-fold reduction in the power of noise. Crowther and coworkers, in developing the common lines approach for recovering the structure of an icosahedral virus from its projection, did state that 'there is in principle no reason why the method should not be extended to systems with lower symmetry' [6], but it was not apparent how this could be practically accomplished for objects lacking symmetry altogether.At the time, the idea of single-particle averaging of entirely asymmetric molecules [7] therefore created some excitement: If such, [i.e. asymmetric single-particle] methods were to be perfected, then, in the words of one scientist, the sky would be the limit [8]. Thus, Robinson's Research News article started with an appreciation of Unwin and Henderson's seminal work, the 3D reconstruction of bacteriorhodopsin

show abstract

Cryo-EM structure of the Plasmodium falciparum 80S ribosome bound to the anti-protozoan drug emetine

Cited by 324 publications

References 54 publications

Structures of the orthosomycin antibiotics avilamycin and evernimicin in complex with the bacterial 70S ribosome

Structures of the orthosomycin antibiotics avilamycin and evernimicin in complex with the bacterial 70S ribosome

Structure of the E. coli ribosome–EF-Tu complex at <3 Å resolution by Cs-corrected cryo-EM

Generalized single-particle cryo-EM – a historical perspective

Contact Info

Product

Resources

About