Crystallization of CcdB in complex with a GyrA fragment

Dao-Thi, Minh Hoa; Melderen, Laurence Van; Genst, Erwin De; Buts, Lieven; Ranquin, An; Wyns, Lode; Loris, Remy

doi:10.1107/s0907444904007814

Cited by 22 publications

(23 citation statements)

References 23 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Both fragments form homodimers in solution. 37 Analysis of native gels showed that both GyrA12 and GyrA14 interact with CcdB and form a non-covalent complex (data not shown). No complex was observed with a mutated GyrA14 R462C fragment, showing that the interaction between CcdB and these two GyrA fragments is specific, thus confirming the critical role of Arg462 in GyrA for CcdB binding and poisoning.…”

Section: Ccdb Binds To the Dimerization Domain Of Gyramentioning

confidence: 88%

“…37,57 The gyrA12 fragment was amplified by PCR from DNA of plasmid pRJR242 which contained the gyrA64 gene ragment 58 using the primers GyrA12 BamHI (5 0 CGGGATCCCTAATCCAGCAGCT CTTTGTATTCGTC) and GyrA12 NdeI (5 0 GGAATT CCATATGAAAGCTCGCGATCGTGCTCATATC) and cloned into the pET15b vector after an N-terminal His6-tag. Expression and purification on a Ni-NTA column were done as described for GyrA14.…”

Section: Protein Purificationmentioning

confidence: 99%

See 1 more Smart Citation

Molecular Basis of Gyrase Poisoning by the Addiction Toxin CcdB

Dao‐Thi¹,

Melderen²,

Genst³

et al. 2005

Journal of Molecular Biology

Self Cite

131

149

View full text Add to dashboard Cite

Section: Ccdb Binds To the Dimerization Domain Of Gyramentioning

confidence: 88%

Section: Protein Purificationmentioning

confidence: 99%

Molecular Basis of Gyrase Poisoning by the Addiction Toxin CcdB

Dao‐Thi¹,

Melderen²,

Genst³

et al. 2005

Journal of Molecular Biology

Self Cite

131

149

View full text Add to dashboard Cite

“…However, each A and B subunit forms dimers. It was previously shown that residues 363 to 494 are important for the dimerization of EcGyrA (13,14). This region does not show any homology with PfGyrA.…”

Section: Vol 6 2007mentioning

confidence: 99%

Molecular Cloning of Apicoplast-Targeted Plasmodium falciparum DNA Gyrase Genes: Unique Intrinsic ATPase Activity and ATP-Independent Dimerization of PfGyrB Subunit

Dar¹,

Sharma²,

Mondal

et al. 2007

Eukaryot Cell

119

View full text Add to dashboard Cite

DNA gyrase, a typical type II topoisomerase that can introduce negative supercoils in DNA, is essential for replication and transcription in prokaryotes. The apicomplexan parasite Plasmodium falciparum contains the genes for both gyrase A and gyrase B in its genome. Due to the large sizes of both proteins and the unusual codon usage of the highly AT-rich P. falciparum gyrA (PfgyrA) and PfgyrB genes, it has so far been impossible to characterize these proteins, which could be excellent drug targets. Here, we report the cloning, expression, and functional characterization of full-length PfGyrB and functional domains of PfGyrA. Unlike Escherichia coli GyrB, PfGyrB shows strong intrinsic ATPase activity and follows a linear pattern of ATP hydrolysis characteristic of dimer formation in the absence of ATP analogues. These unique features have not been reported for any known gyrase so far. The PfgyrB gene complemented the E. coli gyrase temperature-sensitive strain, and, together with the N-terminal domain of PfGyrA, it showed typical DNA cleavage activity. Furthermore, PfGyrA contains a unique leucine heptad repeat that might be responsible for dimerization. These results confirm the presence of DNA gyrase in eukaryotes and confer great potential for drug development and organelle DNA replication in the deadliest human malarial parasite, P. falciparum.DNA topoisomerases are a special class of enzymes that promote the interconversions of various topological forms of DNA that are generated during DNA replication, transcription, recombination, or related processes (8, 12). These enzymes are grouped mainly into two classes, namely, type I and type II, based on their ability to break one or both strands of DNA. Type II enzymes are further divided into A and B subclasses. The archaeon Sulfolobus shibatae contains structurally distinct type IIB topoisomerases (8). Eukaryotic type IIA topoisomerases form homodimers, whereas bacterial type IIA enzymes form heterotetramers comprised of two subunits of A and B polypeptides each (8).The DNA gyrase falls into the type IIA category, and it is responsible for catalyzing ATP-dependent DNA supercoiling activity in prokaryotes (22, 31). The best-studied gyrase so far is from Escherichia coli, which forms an A 2 B 2 complex. The GyrA N-terminal domain contains the DNA breakage and union domain, while the C-terminal domain shows DNA wrapping activity (41, 42). The GyrB N-terminal domain has an ATPase function, whereas the C-terminal domain binds to DNA and probably interacts with GyrA (6, 9, 21). These enzymes are excellent targets for various antibacterial agents including quinolones and coumarins (1,16,32,33).Although gyrase is commonly found in prokaryotes, there are a few recent reports of the existence of bacterium-type gyrases in plants that might be important for organellar DNA replication and transcription. It has been shown that Arabidopsis thaliana DNA gyrase is targeted to the chloroplast and mitochondria and that both subunits are essential for growth (51).Similar to Arabido...

show abstract

“…cell death. A great deal is known about its function and it's crystal structure has been published (Dao-Thi et al, 2004;Dao-Thi et al, 1998;Loris et al, 1999). Moreover there is an E. coli strain that is resistant to CcdB mediated killing (Bernard et al, 1992).…”

Section: The Use Of Ccdb As a Reporter Genementioning

confidence: 99%

“…The mutant TEVsh had 3 amino acid changes from the wild-type (van den Berg et al, 2006). Analysis of the crystal structure of both CcdB (Dao-Thi et al, 2004;Loris et al, 1999) and CAT (Andreeva et al, 2000) showed that a cleavage site between CcdB and CAT might be hidden from the protease. To address this potential problem we adopted a technique termed "Target-directed proteolysis at the ribosome" developed by Henrichs et al, 2005.…”

Section: Redesign Of the Target Plasmidmentioning

confidence: 99%

Discovery and Validation of New Regulatory RNA Elements in Chlamydia trachomatis

AbdelRahman¹

View full text Add to dashboard Cite

show abstract

Crystallization of CcdB in complex with a GyrA fragment

Cited by 22 publications

References 23 publications

Molecular Basis of Gyrase Poisoning by the Addiction Toxin CcdB

Molecular Basis of Gyrase Poisoning by the Addiction Toxin CcdB

Molecular Cloning of Apicoplast-Targeted Plasmodium falciparum DNA Gyrase Genes: Unique Intrinsic ATPase Activity and ATP-Independent Dimerization of PfGyrB Subunit

Discovery and Validation of New Regulatory RNA Elements in Chlamydia trachomatis

Contact Info

Product

Resources

About