Cytotoxic activity of a recombinant GnRH‐PAP fusion toxin on human tumor cell lines

Schlick, Jean-Luc; Dulieu, Philippe; Desvoyes, Bénédicte; Adami, Pascale; Radom, Jean; Jouvenot, Michèle

doi:10.1016/s0014-5793(00)01469-1

Cited by 26 publications

(22 citation statements)

References 51 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…A GnRH fusion with the 66-kDa Pseudomonas exotoxin protein resulted in growth inhibition and killing in a wide variety of hormone-responsive cancer cell lines, including ovarian and breast cancer lines (42,43). The fused GnRH peptide also efficiently delivered Pokeweed antiviral protein (44) and proapoptotic proteins Bik, Bax, Bak (45), and DFF40 (46) to several adenocarcinoma cell lines where they were able to significantly inhibit growth. Therefore, the GnRH fusion protein strategy has been proven to deliver functional proapoptotic proteins that can inhibit cell proliferation of the hormone-responsive cells.…”

Section: Discussionmentioning

confidence: 99%

Recombinant, refolded tetrameric p53 and gonadotropin-releasing hormone-p53 slow proliferation and induce apoptosis in p53-deficient cancer cells

LaFevre-Bernt

Wu²,

Lin³

2008

Molecular Cancer Therapeutics

View full text Add to dashboard Cite

The p53 tumor suppressor is mutated in over 50% of human cancers. Mutations resulting in amino acid changes within p53 result in a loss of activity and consequent changes in expression of genes that regulate DNA repair and cell cycle progression. Replacement of p53 using protein therapy would restore p53 function in p53-deficient tumor cells, with a consequence of tumor cell death and tumor regression. p53 functions in a tetrameric form in vivo. Here, we refolded a wild-type, full-length p53 from inclusion bodies expressed in Escherichia coli as a stable tetramer. The tetrameric p53 binds to p53-specific DNA and, when transformed into a p53-deficient cancer cell line, induced apoptosis of the transformed cells. Next, using the same expression and refolding technology, we produced a stable tetramer of recombinant gonadotropin-releasing hormone-p53 fusion protein (GnRH-p53), which traverses the plasma membrane, slows proliferation, and induces apoptosis in p53-deficient, GnRH-receptor -expressing cancer cell lines. In addition, we showed a time-dependent binding and internalization of GnRH-p53 to a receptor-expressing cell line. We conclude that the GnRH-p53 fusion strategy may provide a basis for constructing an effective cancer therapeutic for patients with tumors in GnRH-receptorpositive tissue types.

show abstract

Section: Discussionmentioning

confidence: 99%

Recombinant, refolded tetrameric p53 and gonadotropin-releasing hormone-p53 slow proliferation and induce apoptosis in p53-deficient cancer cells

LaFevre-Bernt

Wu²,

Lin³

2008

Molecular Cancer Therapeutics

View full text Add to dashboard Cite

show abstract

“…There are several possibilities that could account for the different results in our study as compared with Schlick et al (39). Although our GnRH-fPAP fusion protein and the one described by Schlick et al (39) appear to have the same amino acid sequence, the folding and/or three-dimensional structure may be subtly altered due to different purification procedures.…”

Section: Discussionmentioning

confidence: 66%

“…Although our GnRH-fPAP fusion protein and the one described by Schlick et al (39) appear to have the same amino acid sequence, the folding and/or three-dimensional structure may be subtly altered due to different purification procedures. Second, different cell lines were used in the two studies.…”

Section: Discussionmentioning

confidence: 93%

“…The antisense primer (CGCAAGCTTTCAAGTTGTCTGACAGCTCCC) was designed to introduce a HindIII restriction site (underline) at the 3Ј-end of the mature PAP (mPAP) gene. We also designed another antisense primer (5Ј-CGCAAGCTT-TCAGAATCCTTCAAATAGAT-3Ј) to acquire the full-length cDNA of PAP (fPAP) following procedure described by Schlick et al (39).…”

Section: Methodsmentioning

confidence: 99%

“…More recently, fusion proteins consisting of GnRH and PAP or PE have been produced and shown to inhibit growth of cultured tumor cells expressing GnRH receptors (37)(38)(39); however, the activity of the fusion proteins has not been directly compared with the activities of hormonotoxins produced by conjugation of a GnRH analog to the toxic protein moiety.…”

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

Binding and Cytotoxicity of Conjugated and Recombinant Fusion Proteins Targeted to the Gonadotropin-Releasing Hormone Receptor

Nett

Allen

et al. 2004

Cancer Research

View full text Add to dashboard Cite

Pokeweed antiviral protein (PAP) is a plant-derived, highly potent ribosome inactivating protein that causes inhibition of protein translation and rapid cell death. We and others have delivered this protein to various cell types, including cancer cells, using hormones to specifically target cells bearing the hormone receptor. Here, we compare binding and cytotoxicity of GnRH-PAP hormonotoxins prepared either by protein conjugation (GnRH-PAP conjugate) or through recombinant DNA technology (GnRH-PAP fusion). Although GnRH-PAP conjugate protein bound specifically to and caused cell death in cells bearing the gonadotropinreleasing hormone (GnRH) receptor, we could not detect binding or cytotoxicity using two different versions of the fusion protein in receptorpositive cells. We conclude that generation of an active GnRH-PAP fusion protein may not be feasible either because both ends of the GnRH molecule are required for receptor binding, but only the NH 2 terminus is free in the fusion protein and/or that more potent analogues of GnRH (inclusion of which is not feasible in the fusion protein) are needed for efficient targeting. In contrast, the GnRH-PAP conjugate shows promise as a novel anticancer agent, capable of targeting cancer cells expressing the GnRH receptor such as prostate, breast, ovarian, endometrial, and pancreatic cells. It may also be useful as a therapeutic agent to eliminate pituitary gonadotrophs, eliminating the need for chronic GnRH analogue administration to treat hormone-sensitive diseases.

show abstract

Targeting to Peptide Receptors

Schally

Halmos

2011

Drug Delivery in Oncology

View full text Add to dashboard Cite

Cytotoxic activity of a recombinant GnRH‐PAP fusion toxin on human tumor cell lines

Cited by 26 publications

References 51 publications

Recombinant, refolded tetrameric p53 and gonadotropin-releasing hormone-p53 slow proliferation and induce apoptosis in p53-deficient cancer cells

Recombinant, refolded tetrameric p53 and gonadotropin-releasing hormone-p53 slow proliferation and induce apoptosis in p53-deficient cancer cells

Binding and Cytotoxicity of Conjugated and Recombinant Fusion Proteins Targeted to the Gonadotropin-Releasing Hormone Receptor

Targeting to Peptide Receptors

Contact Info

Product

Resources

About