Daily alcohol intake triggers aberrant synaptic pruning leading to synapse loss and anxiety-like behavior

Abstract

Alcohol abuse adversely affects the lives of millions of people worldwide. Deficits in synaptic transmission and in microglial function are commonly found in human alcohol abusers and in animal models of alcohol intoxication. Here, we found that a protocol simulating chronic binge drinking in male mice resulted in aberrant synaptic pruning and substantial loss of excitatory synapses in the prefrontal cortex, which resulted in increased anxiety-like behavior. Mechanistically, alcohol intake increased the engulfment capacity of microglia in a manner dependent on the kinase Src, the subsequent activation of the transcription factor NF-κB, and the consequent production of the proinflammatory cytokine TNF. Pharmacological blockade of Src activation or of TNF production in microglia, genetic ablation of Tnf, or conditional ablation of microglia attenuated aberrant synaptic pruning, thereby preventing the neuronal and behavioral effects of the alcohol. Our data suggest that aberrant pruning of excitatory synapses by microglia may disrupt synaptic transmission in response to alcohol abuse.

Astrocyte-derived TNF and glutamate critically modulate microglia reactivity by methamphetamine

“…Therefore, a better understanding of the microglia reactivity and associated brain immune-pathways in response to psychostimulants is paramount to implement relevant interventions for treating addictive behaviors. In accordance, we have recently demonstrated that binge alcohol administration to adult mice causes aberrant synaptic pruning and loss of prefrontal cortex excitatory synapses, increasing anxiety-like behavior, which is prevented by pharmacological blockade of Src activation or by reducing TNF production in microglia 21 .…”

“…TNF knockout mice in the C57BL/6 background (referred herein as TNF KO) were kindly supplied by Professor Rui Appelberg (University of Porto). TNF KO mice 21 were maintained at i3S and genotyped by PCR using ATCCGCGACGTGGAACTGGCAGAA (forward) and CTGCCCGGACTCCGCAAAGTCTAA (reverse) primer pair. IP3R2 KO mice 23, 24 were held at ICVS animal facility and genotyped PCR using the primer pairs: WT (F, 5’-ACCCTGATGAGGGAAGGTCT-3’; R, 5’-ATCGATTCATAGGGCACACC-3’) and mutant allele (neo-specific primer: F, 5’-AATGGGCTGACCGCTTCCTCGT-3’; R, 5’-TCTGAGAGTGCCTGGCTTTT-3’).…”

“…Anxiety-like behavior was assessed using the elevated plus maze (EPM) test precisely as we previously described 21, 37 . The test was conducted in the dark phase of the light/dark cycle.…”

Multi-omics integration analysis identifies novel genes for alcoholism with potential overlap with neurodegenerative diseases

“…Because of the small fraction of microglia in bulk brain tissue, it is difficult to study the expression of this transcription factor in transcriptomic datasets from whole brains. Some studies using animal models have reported that chronic alcohol consumption can influence the expression of PU.1 in isolated microglia 35 and peripheral lung macrophages 36,37 . However, these studies report the consequences of drinking on PU.1 expression whereas our study uses genomic evidence to demonstrate that regulation of innate immune response likely underlies, at least in part, susceptibility to increased drinking and eventual risk for AUD.…”

Rac1 signaling in microglia is essential for synaptic proteome plasticity and experience-dependent cognitive performance

“…The following markers were used to characterize microglia in the samples: CD45 CD11b and Ly6C. Microglia were collected from the brains of control and mutant mice using density gradient separation as before (4,37). Single-cell suspensions (5 x 10 5 cells) were incubated with different mixes of FACS antibodies for 30 min at 4°C in the dark.…”