DD3 gene expression in peripheral blood of patients with prostate cancer and with benign prostate hyperplasia as a molecular diagnostic

Oliveira, Jaqueline das Dores Dias; Goulart, Luiz Ricardo; Waldesse, P.O; Meola, Juliana; Neves, Adriana Freitas

doi:10.1016/s1569-9056(03)90463-5

Cited by 7 publications

(2 citation statements)

References 0 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…-3') KLK3 TCCAATGACGTGTGTGCGCA CCTTGATCCACTTCCGGTAA PCA3 CCGAGGGAGACCAGGAAGAT ATCGATGACCCAAGATGGCG TMPRSS1-ERG CGCGGCAGGAAGCCTTA TCCGTAGGCACACTCAAACAAC GAPDH TGAAGGTCGGAGTCAACGGA CATCGCCCCACTTGATTTTGG REST analysis of the Ct values of the PCA3 (DD3) gene revealed that the expression of this gene in Groups 1, 2 and 3 was not statistically significantly different as compared to Group 4 (p < 0.05). Unlike our results, other authors [3][4][5] have reported increased gene expression of the PCA3 gene in tumour tissue compared to control tissue. This difference can be attributed to fact that, in these studies, the expression is measured in tissues, whereas we measured the mRNA levels in urine samples.…”

Section: Rest Analysiscontrasting

confidence: 99%

Cut-off value for KLK3 gene expression from urine sediment to rationalize diagnosis of prostate cancer

Ramić

Kulovac

Lojo-Kadric

et al. 2020

Biotechnology & Biotechnological Equipment

View full text Add to dashboard Cite

Although prostate cancer accounts for the highest number of newly diagnosed cases of cancer in men, it represents a specific diagnostic challenge in modern oncology. The standard diagnosis of prostatic carcinoma begins with the screening of serum concentrations of PSA (Prostate Specific Antigen). If the concentration of serum PSA levels is above 4 ng/mL, the patient is further referred to a digital rectal examination in order to determine an increase in prostate volume. In cases where enlargement of the prostate is observed, the next step is biopsy of prostate tissue. This physically painful and invasive approach to confirm the diagnosis is often unnecessary because, in many cases, the patohistologic analysis determines diagnosis of benign prostatic hyperplasia, and not a tumor. In this study, we investigated the possibilities of detection and measurement of the relative level of gene expression of the KLK3 (Kallikrein-related peptidase 3), PCA3 (Prostate Cancer Gene 3) and TEMPRSS: ERG (Transmembrane protease ser-ine2 and in-ETS erythroblostosis virus E26 oncogene homolog) genes from the urine samples of patients with prostatic diseases and healthy controls. Urine was the sample of choice because it is taken in a non-invasive manner, and could potentially serve to make better selection to biopsy. One of the selected genes (KLK3) differed significantly in the samples of various pathological conditions of the prostate, and therefore we consider that its further investigation is reasonable. ARTICLE HISTORY

show abstract

Section: Rest Analysiscontrasting

confidence: 99%

Cut-off value for KLK3 gene expression from urine sediment to rationalize diagnosis of prostate cancer

Ramić

Kulovac

Lojo-Kadric

et al. 2020

Biotechnology & Biotechnological Equipment

View full text Add to dashboard Cite

show abstract

“…Therefore, validated DD3 PCA3 assays could become valuable for the detection of disseminated prostate cancer cells in serum or plasma [43]. Multicenter studies using the validated DD3 PCA3 assay can provide the first basis for the molecular diagnostics in clinical urological practice (Table II).…”

Section: Dd3 Pca3mentioning

confidence: 99%

Molecular prostate cancer pathology: Current issues and achievements

Schalken¹,

Bergh

Bono

et al. 2005

Scandinavian Journal of Urology and Nephrology

View full text Add to dashboard Cite

Recent developments in the field of molecular techniques have provided new tools that have led to the discovery of many new promising biomarkers for prostate cancer. These biomarkers may be instrumental in the development of new tests that will have a high specificity for the diagnosis and prognosis of prostate cancer. A biomarker is defined as a molecular test that provides additional information to currently available clinical and pathological tests. Biomarkers should be reproducible (both within and between institutes) and have an impact on clinical management. For diagnostic purposes it is important that potential biomarkers are tested in terms of tissue specificity and their discrimination potential between prostate cancer, normal prostate and benign prostatic hyperplasia. The results of (multiple) biomarker-based assays may enhance the specificity of cancer detection. There is an urgent need for molecular prognostic biomarkers for predicting the biological behavior and outcome of cancer.

show abstract

Combined analysis of multiple mRNA markers by RT-PCR assay for prostate cancer diagnosis

Neves

Araújo

Biase

et al. 2008

Clinical Biochemistry

View full text Add to dashboard Cite

DD3 gene expression in peripheral blood of patients with prostate cancer and with benign prostate hyperplasia as a molecular diagnostic

Cited by 7 publications

References 0 publications

Cut-off value for KLK3 gene expression from urine sediment to rationalize diagnosis of prostate cancer

Cut-off value for KLK3 gene expression from urine sediment to rationalize diagnosis of prostate cancer

Molecular prostate cancer pathology: Current issues and achievements

Combined analysis of multiple mRNA markers by RT-PCR assay for prostate cancer diagnosis

Contact Info

Product

Resources

About