Dead Cas9–sgRNA Complex Shelters Vulnerable DNA Restriction Enzyme Sites from Cleavage for Cloning Applications

Abstract

The creation of the nuclease-dead Cas protein (dCas9) offers a new platform for a plethora of new discoveries. Diverse dCas9 tools have been developed for transcription regulation, epigenetic engineering, base editing, genome imaging, genetic screens, and chromatin immunoprecipitation. Here, we show that dCas9 and singleguide RNA preassembled to form ribonucleoprotein dCas9-sgRNA (referred to as dRNP) is capable of specifically and reversibly blocking the activity of DNA cleavage by restriction enzymes (REs). We show that the inhibition of RE activities occurs when the recognition or the cleavage site of the DNA is overlapped by the sgRNA or the protospacer adjacent motif sequence. Furthermore, we show that multiple dRNPs can be used simultaneously to inhibit more than one RE sites. As such, we exploited this novel finding as a method to demonstrate that inserts can be ligated into vectors, and vice versa, whereby selective RE sites are temporarily sheltered to allow the desired cloning.

A Genetically encoded BRET-based SARS-CoV-2 Mpro protease activity sensor

“…One Shot TOP10 Competent E. coli cells were transformed with 2 μL of the ligation reaction and plated in LB agar plates with 100 μg/ml ampicillin. Sequences were confirmed by Sanger sequencing 79 using a pair of forward and reverse primers, 5 ‘ GCACAGCCAGAACCACATATACCTT 3 ‘and 5 ‘ CACCACCTTGAAGATCTTCTCGATCT 3 ‘, respectively. For bacterial expression and purification of the M pro sensor, the mNG-M pro -Nter-auto-NLuc plasmid construct was digested with Hind III and Xho I and the mNG-M pro -Nter-auto-NLuc fragment was subcloned into similarly digested pET-28b(+) plasmid.…”

A simple protocol to isolate a single human cell PRDX1 knockout generated by CRISPR-Cas9 system

“… Note: store 100 μL of the 16–18 hrs culture for maxi prep with Endotoxin free Qiagen kit. Positive clones are identified by DNA Sanger sequencing ( Saifaldeen et al., 2021 ) using a pair of forward and reverse primers (see key resources table ). The 100 μL of stored culture carrying the correct plasmid PX330 with the Cas9 and the specific guide RNA can be subcultured into 100 mL of LB with Amp and used for Maxi prep Endotoxin free (Qiagen) to isolate a sufficient amount of the plasmid expressing the gRNA for transfection.…”

“…Positive clones are identified by DNA Sanger sequencing ( Saifaldeen et al., 2021 ) using a pair of forward and reverse primers (see key resources table ).…”

“… Select five colonies and inoculate into 5 mL of LB + Kanamycin (50 μg/mL) followed by miniprep plasmid DNA extraction (Qiagen mini prep kit). Perform Sanger sequencing using M-13 primers ( key resources table ) and using the protocol described by Saifaldeen et al. (2021) .…”

“…Perform Sanger sequencing using M-13 primers ( key resources table ) and using the protocol described by Saifaldeen et al. (2021) .…”