Decorin‐PEI nanoconstruct attenuates equine corneal fibroblast differentiation

Abstract

Twenty-two kilo dalton Polyethylenimine nanoparticles are safe and effective for equine corneal gene therapy in vitro. PEI-mediated DCN gene delivery is effective at inhibiting TGFβ-mediated fibrosis in this model.

Development of a novel ex vivo equine corneal model

“…β‐actin was used as the housekeeping gene with the forward primer being CGGCTACAGCTTCACCACCA and the reverse primer being CGGGCAGCTCGTAGCTCTTC. These primers had previously been validated on equine corneal cells . The efficacy of each primer was determined by using each PCR primer expression ratio.…”

“…Corneal disease in horses includes ulcerative, fungal, traumatic, and neoplastic conditions . While these diseases are currently treated with a variety of medical and surgical modalities, permanent vision loss commonly results due to extensive corneal fibrosis.…”

“…Equine corneal research to date has typically been performed using either in vitro model systems or in vivo studies utilizing a low number of animals . In vitro models utilize monocultures of representative corneal cell populations and cannot fully evaluate potential pathologic and toxic changes that may occur in the multilayered cornea.…”

Biomateriais para formulações de base nanotecnológica visando terapia gênica ocular

“…113 Nanopartículas de PEI 22kDa associando pDNA (razão N/P 15) foram utilizadas para transfecção in vitro de fibroblastos corneais equinos. 114 Esse sistema foi capaz de impedir a diferenciação de fibroblastos relacionada ao TGF-β (fator de transformação do crescimento beta), apresentando toxicidade aceitável. Não obstante, para a terapia genética ocular, a PEI é geralmente associada a outros materiais de modo a diminuir a sua toxicidade ou vetorizar a sua interação com determinados grupos celulares.…”

Altering equine corneal fibroblast differentiation through Smad gene transfer

“…Once resolved, the cornea is often left with a scar that leads to a reduction in the visual field. Corneal scar formation is a recognized problem afflicting not only horses, but in many of our domestic animal species, as well as people . This loss of corneal transparency can result in a horse being unable to perform its duties such as racing, jumping, or trail riding and can prove to be dangerous to both itself and his/her handler …”