Decreased expression of the glutathione S-transferases alpha and pi genes in human renal cell carcinoma

Abstract

Using the polymerase chain reaction (PCR), a human kidney glutathione S-transferase (GST) alpha cDNA clone (GST alpha 12 K) was synthesized; it is identical to a known liver GST alpha cDNA clone except for one base change (G----A), indicating that an alpha class gene expressed in human kidney is similar to one expressed in human liver. Comparisons were made in the expression of GST alpha and GST pi between renal cell carcinoma and adjacent non-neoplastic tissue. Messenger RNA expression in 30 cases was determined by Northern blotting, and GST protein from nine of these cases was analyzed by HPLC. The GST alpha gene products were expressed at near-zero levels. The GST pi gene product was the predominant GST in tumors, but was decreased in absolute amount compared with control tissue, the tumor/control ratios for the GST pi gene obtained by Northern blots and HPLC analysis being 0.50 +/- 0.07 and 0.36 +/- 0.07 respectively. The resulting pattern in renal cell carcinoma therefore shows a predominance of GST pi. Since it is assumed that renal cell carcinoma derives from the proximal tubular epithelial cells which are high in GST alpha, this implies a dedifferentation in the GST expression pattern.

Cloning, sequencing and characterization of the human Alpha glutathione S-transferase gene corresponding to the cDNA clone pGTH2

“…Isolation of a human Alpha GST clone By using the human kidney Alpha GST cDNA clone GSTa l2k as a probe [5], a human cosmid library was screened, revealing a positive clone called cosGTH2.…”

“…Southern blots of overlapping fragments of cosGTH2 revealed hybridization to the 3' region (exons 6 and 7) and 5' region (exon [1][2][3][4][5] *********************************************gjtaggttctgagtta 154 205 TTTGAAGAGAAATTTATAAAATCTGCAGAAGATTTGGACAAGTTAAGAAATG tgtttctgcttccag****************************************************gtaagatcaacctct tgtttctgcttccag***************C********C*******A*******************gtaagatgaagtctc 206 ATGGATATTTGATGTTCCAGCAAGTGCCAATGGTTGAGATTGATGGGATGAAGCTGGTGCAGACCAGAGCCA tccttctttgtaaag****GAG**************T****T****************CA*************************** 338 TTCTCAACTACATTGCCAGCAAATACAACCTCTATGGGAAAGACATAAAGGAGAAAGCCCT *******************************T*************C********G******gtatggtatagtttc 339 GATTGATATGTATATAGAAGGTATAGCAGATTTGGGTGAAATGATCCTTCTTCTGCCCTTTACTCAACCTGA 480 GGAACAAGATGCCAAGCCCTGCCTTGATCCAAGAGAAAAcAAAAAATCGCTACTTCCCTGCCTTTGAAAAA 481 GTCTTAAAGAGCCACGGACAAGACTACCTTGTTGGCAACAAGCTGAGCCGGGCTGACATTCACCTGGTGGAA tcctcccatctccag************************************************************************ 612 CTTCTCTACTACGTGGAAGAGCTTGACTCTAGCCTTATTTCCAGCTTCCCTCTGCTGAAG ************************************************************gtgacccattteaca GYLMFQQVP MVEIDGMKLV QTRAILNYIA SKYNLYGKDI KEKAL cosGTH2 ********* ********** ********** ********** ***** cosGTH2+ *S****L*S *****R**** ********** *********T **R** EXON 5 pGTH2…”

“…These enzymes catalyse the conjugation ofGSH to a variety of electrophilic compounds and exhibit tissue-and developmentspecific expression patterns [2][3][4]. Differences in Alpha GST expression were observed between normal and malignant tissue, with very low levels present in the latter [5,6].…”

“…analysis demonstrates two GST Alpha subunits in liver and kidney, referred to as a. and ay or a, and a2 respectively; the former is more basic than the latter [5,7], the pl being 8.9 for al and 8.4 for a2 [1].…”

“…This indicates that the human Alpha GSTs are products of at least two different genes [10]. A cDNA clone from human kidney, GSTal2k, synthesized by the PCR method [5] is equivalent to the liver cDNA clone pGTH 1 [8] or AGST2-3 [9], except for a base change (G--A) at position 442 in pGTH1 (position 430 in AGST2-3).…”