Dedicated Roles of Plastid Transketolases during the Early Onset of Isoprenoid Biogenesis in Pepper Fruits1

Abstract

Isopentenyl diphosphate (IPP), which is produced from mevalonic acid or other nonmevalonic substrates, is the universal precursor of isoprenoids in nature. Despite the presence of several isoprenoid compounds in plastids, enzymes of the mevalonate pathway leading to IPP formation have never been isolated or identified to our knowledge. We now describe the characterization of two pepper (Capsicum annuum L.) cDNAs, CapTKT1 and CapTKT2, that encode transketolases having distinct and dedicated specificities. CapTKT1 is primarily involved in plastidial pentose phosphate and glycolytic cycle integration, whereas CapTKT2 initiates the synthesis of isoprenoids in plastids via the nonmevalonic acid pathway. From pyruvate and glyceraldehyde-3-phosphate, CapTKT2 catalyzes the formation of 1-deoxy-xylulose-5-phosphate, the IPP precursor. CapTKT1 is almost constitutively expressed during the chloroplast-to-chromoplast transition, whereas CapTKT2 is overexpressed during this period, probably to furnish the IPP necessary for increased carotenoid biosynthesis. Because deoxy-xylulose phosphate is shared by the plastid pathways of isoprenoid, thiamine (vitamin B 1 ), and pyridoxine (vitamin B 6 ) biosynthesis, our results may explain why albino phenotypes usually occur in thiaminedeficient plants.Because of the combined activities of mevalonatesynthesizing and -activating enzymes, IPP is known as the universal isoprenoid building block. How IPP is synthesized and channeled into plastid isoprenoids to support the production of carotenoids, chlorophylls, prenylquinones, and diterpenes is largely unknown. Two hypotheses have been proposed. One is that plastids operate autonomously, synthesizing plastid isoprenoids directly from carbon dioxide or from plastid glycolytic intermediates such as pyruvate (Goodwin, 1971;Moore and Shephard, 1978; Heintze et al., 1990 Heintze et al., , 1994McCaskill and Croteau, 1995). However, the mechanism of carbon flow via a pyruvate intermediate is unknown for plants. A second hypothesis is that IPP is transported from the cytosol (Kleinig, 1989), which is based on the finding that hydroxymethylglutaryl CoA reductase and mevalonate-activating enzymes are absent in plastids (Gray, 1987). This view is reinforced by the fact that mevilonin, a specific inhibitor of 3-hydroxy-3-methylglutaryl-CoA reductase, drastically inhibits cytosolic sterol biosynthesis at moderate concentrations but does not affect isoprenoid synthesis in plastids (Bach and Lichtenthaler, 1983). This led to consideration of an alternative IPP-generation system. In fact, such a pathway is known for prokaryotes, in which IPP is formed via deoxy-xylulose phosphate rather than by mevalonate (Rohmer et al., 1993) in a transketolation reaction between pyruvate and glyceraldehyde-3-phosphate . In vivo precursor labeling indicates that a similar pathway operates for the synthesis of ginkgolides (Schwarz, 1994) and plastid isoprenoids (Schwender et al., 1996; Arigoni et al., 1997;Lichtenthaler et al., 1997aLichtenthaler et al., , 1997b.In t...

Identification of neoxanthin synthase as a carotenoid cyclase paralog

“…Several sense and reverse oligonucleotides encoding CCS peptides [6] (Fig. 2) were used without degeneracy to reverse transcribe and amplify by PCR a putative CCS homologue from tomato, according to a previously described procedure [12]. The sense oligonucleotides (S) used: S 1 , GTTAACATCT-CATGGGTT; S 2 , ACTGATCTGGACGGGGCTGAA; S 3 , CATAAGTGGCCTGTGAGTTGT and S 4 , TTGTTGAA-TAGTTGTGTTGAA encoded, respectively, the peptide sequences, VNISWV, TDLDGAE, HKWPVSC and LLNSCVE of CCS.…”

“…To this end, a BamHI site and a SacI site were, respectively, introduced at the 5 H and 3 H ends, respectively, of the putative mature NSY cDNA by PCR [12] using Pfu polymerase (Stratagene) prior to subcloning. The sense oligonucleotide (CGCGGAT-CCTTTCTTGATTTAGCACCCACATCAAAG) containing the BamHI site encoding the peptide sequence FLDLAPTSK and the reverse oligonucleotide (TCCGAGCTCTAAGCTCTC-TATTGCTAGATTGCC) containing the SacI site encoding the peptide sequence GNLAIESL of NSY were used.…”

“…Other analytical methods SDS/PAGE and Western blot analysis of protein were performed as described previously [12]. Due to the high amino-acid sequence identity between CCS and NSY, polyclonal antibodies previously raised against CCS [6,8] recognized NSY and were used for immunoblotting at a dilution of 1: 10 000.…”

Biosynthesis of terpenoids: YgbB protein converts 4-diphosphocytidyl-2C-methyl- d -erythritol 2-phosphate to 2C-methyl- d -erythritol 2,4-cyclodiphosphate

“…1 and 2). 1-Deoxy-D-xylulose serves as an efficient precursor of terpenoids via this alternative pathway (3)(4)(5)(6)(7)(8), and its 5-phosphate (3) was shown to be formed from glyceraldehyde 3-phosphate (1) and pyruvate (2) (3, 9, 10) by an enzyme specified by the dxs gene of Escherichia coli (11,12) and its plant orthologs (13,14) (Fig. 1).…”

Characterization of 1-Deoxy-d-xylulose 5-Phosphate Reductoisomerase, an Enzyme Involved in Isopentenyl Diphosphate Biosynthesis, and Identification of Its Catalytic Amino Acid Residues

“…1). The dxs gene homologs encoding the enzyme have been cloned from Escherichia coli (3,4), peppermint (Mentha X piperita) (5), pepper (6), and Streptomyces sp. strain CL190 (7).…”