Degenerative phenotypes caused by the combined deficiency of murine HIP1 and HIP1r are rescued by human HIP1

Abstract

The members of the huntingtin-interacting protein-1 (HIP1) family, HIP1 and HIP1-related (HIP1r), are multi-domain proteins that interact with inositol lipids, clathrin and actin. HIP1 is over-expressed in a variety of cancers and both HIP1 and HIP1r prolong the half-life of multiple growth factor receptors. To better understand the physiological importance of the HIP1 family in vivo, we have analyzed a large cohort of double Hip1/Hip1r knockout (DKO) mice. All DKO mice were dwarfed, afflicted with severe vertebral defects and died in early adulthood. These phenotypes were not observed during early adulthood in the single Hip1 or Hip1r knockouts, indicating that HIP1 and HIP1r compensate for one another. Despite the ability of HIP1 and HIP1r to modulate growth factor receptor levels when over-expressed, studies herein using DKO fibroblasts indicate that the HIP1 family is not necessary for endocytosis but is necessary for the maintenance of diverse adult tissues in vivo. To test if human HIP1 can function similar to mouse HIP1, transgenic mice with 'ubiquitous' expression of the human HIP1 cDNA were generated and crossed with DKO mice. Strikingly, the compound human HIP1 transgenic DKO mice were completely free from dwarfism and spinal defects. This successful rescue demonstrates that the human HIP1 protein shares some interchangeable functions with both HIP1 and HIP1r in vivo. In addition, we conclude that the degenerative phenotypes seen in the DKO mice are due mainly to HIP1 and HIP1r protein deficiency rather than altered expression of neighboring genes or disrupted intronic elements.

Region‐specific epithelial cell dynamics during branching morphogenesis

“…A plasmid containing the KikGR coding sequence, pCS2+KikGR, and pCLE GFP were kind gifts from Dr. Atsushi Miyawaki (RIKEN) and Dr. Andrzej Dlugosz (University of Michigan), respectively (Tsutsui et al, 2005;Bradley et al, 2007). KikGR and a Kozak sequence flanked by NotI and NheI sites were amplified by PCR using the 5' primer GCGGCCGCCACCATGGTGAGTGTGATTACATCAGAAATGAAGATCGAGCTG and 3' primer GCTAGCTTACTTGGCCAGCCTTGGCAGCCCGGAATGAGC.…”

Hip1r is expressed in gastric parietal cells and is required for tubulovesicle formation and cell survival in mice

“…Hip1r-deficient mice are viable and fertile, with no obvious morphological abnormalities (10). Moreover, in contrast to the marked changes in vesicular trafficking shown in knockdown experiments in cultured HeLa cells (5,8), clathrin trafficking pathways were normal in mouse embryonic fibroblasts isolated from either Hip1r-deficient mice or mice deficient in both Hip1 and Hip1r (10,11), thus calling into question the in vivo importance of these proteins for clathrin-mediated vesicular trafficking. The similar protein structures and broad cell and tissue distribution of Hip1 and Hip1r raise the possibility that Hip1 could compensate for the loss of Hip1r in vivo.…”

Huntingtin-interacting protein 1-related is required for accurate congression and segregation of chromosomes

“…Increased cataracts is also due to cell death in the lens and kypholordosis. Furthermore, mice deficient in both HIP1 and HIP1r are characterized by accelerated development of the abnormalities common in HIP1-deficient mice (15,16). All of the phenotypes observed in multiple tissue types were likely attributable to diminished cellular proliferation and increased apoptosis.…”

“…It is likely that the mitotic functions of HIP1 family proteins are limited to HIP1r. To date, it is generally believed that HIP1 and HIP1r have overlapping roles in vivo and can compensate for the loss of each other, since the HIP1/HIP1r DKO mouse phenotype is more severe compared to the HIP1 or HIP1r single knockout phenotype (16). However, HIP1r differs from HIP1 in several aspects.…”

“…However, it was unexpectedly found that embryonic fibroblasts derived from either HIP1 or HIP1r single knockout mice do not have any endocytic defects (3,14,15). Additionally, double HIP1/HIP1r knockout (DKO) mouse embryonic fibroblasts have no clearly observable defects in clathrin trafficking, growth factor signaling, or the actin pathway (15,16). All observed data using knockout mice suggest that HIP1 family proteins play roles in the regulation of http://bmbreports.org were synchronized by sequential combination of 10 mM thymidine and 1 μM nocodazole.…”