Delayed induction of proinflammatory cytokines and suppression of innate antiviral response by the novel Middle East respiratory syndrome coronavirus: implications for pathogenesis and treatment

Lau, Susanna K. P.; Lau, Candy C. Y.; Chan, Kwok Hung; Li, Clara P.Y.; Chen, Honglin; Jin, Dong Yan; Chan, Jasper Fuk‐Woo; Woo, Patrick C. Y.; Yuen, Kwok‐Yung

doi:10.1099/vir.0.055533-0

Cited by 380 publications

(367 citation statements)

References 57 publications

Supporting

Mentioning

344

Contrasting

Unclassified

Order By: Relevance

“…According to our protocol ( 19 , 20 ), all samples positive for DcCoV UAE-HKU23 by RT-PCR were subjected to quantitative RT-PCR (qRT-PCR).The assay was performed, as described ( 27 ), using a real-time 1-step qRT-PCR with DcCoV UAE-HKU23 primers 5�?�-ATAGCGGCTACACGTGGTGTT-3�?� and 5�?�-TCCCAGCCGCCATAAAACT-3�?� and probe 5�?�-(FAM) CTGTTGTTATAGGCACCACT (BHQ1)-3�?�. To generate calibration curves, we prepared a series of 6 log 10 dilutions equivalent to 10 1 �?…”

Section: Methodsmentioning

confidence: 99%

Novel Betacoronavirus in Dromedaries of the Middle East, 2013

Woo¹,

Lau²,

Wernery³

et al. 2014

Emerg. Infect. Dis.

Self Cite

102

106

View full text Add to dashboard Cite

In 2013, a novel betacoronavirus was identified in fecal samples from dromedaries in Dubai, United Arab Emirates. Antibodies against the recombinant nucleocapsid protein of the virus, which we named dromedary camel coronavirus (DcCoV) UAE-HKU23, were detected in 52% of 59 dromedary serum samples tested. In an analysis of 3 complete DcCoV UAE-HKU23 genomes, we identified the virus as a betacoronavirus in lineage A1. The DcCoV UAE-HKU23 genome has G+C contents; a general preference for G/C in the third position of codons; a cleavage site for spike protein; and a membrane protein of similar length to that of other betacoronavirus A1 members, to which DcCoV UAE-HKU23 is phylogenetically closely related. Along with this coronavirus, viruses of at least 8 other families have been found to infect camels. Because camels have a close association with humans, continuous surveillance should be conducted to understand the potential for virus emergence in camels and for virus transmission to humans.

show abstract

Section: Methodsmentioning

confidence: 99%

Novel Betacoronavirus in Dromedaries of the Middle East, 2013

Woo¹,

Lau²,

Wernery³

et al. 2014

Emerg. Infect. Dis.

Self Cite

102

106

View full text Add to dashboard Cite

show abstract

“…53 MERS-CoV productively infects activated human T cells and induces delayed cytokine responses after infection of human myeloid cells in vitro, both of which could impair virus clearance and the development of an effective immune response. [54][55][56] During the acute phase of MERS, robust virus-specific CD8 T-cell responses were detected in most patients with severe or moderate disease, with antibody and CD4 T-cell responses appearing later in the disease course. 57 T-cell and antibody responses were reliably detected 2-3 weeks after diagnosis, although they were detected earlier in some patients.…”

Section: Protective and Deleterious Immune Responsesmentioning

confidence: 99%

Middle East respiratory syndrome

et al. 2020

View full text Add to dashboard Cite

The Middle East respiratory syndrome coronavirus (MERS-CoV) is a lethal zoonotic pathogen that was first identified in humans in Saudi Arabia and Jordan in 2012. Intermittent sporadic cases, community clusters, and nosocomial outbreaks of MERS-CoV continue to occur. Between April 2012 and December 2019, 2499 laboratory-confirmed cases of MERS-CoV infection, including 858 deaths (34·3% mortality) were reported from 27 countries to WHO, the majority of which were reported by Saudi Arabia (2106 cases, 780 deaths). Large outbreaks of human-to-human transmission have occurred, the largest in Riyadh and Jeddah in 2014 and in South Korea in 2015. MERS-CoV remains a high-threat pathogen identified by WHO as a priority pathogen because it causes severe disease that has a high mortality rate, epidemic potential, and no medical countermeasures. This Seminar provides an update on the current knowledge and perspectives on MERS epidemiology, virology, mode of transmission, pathogenesis, diagnosis, clinical features, management, infection control, development of new therapeutics and vaccines, and highlights unanswered questions and priorities for research, improved management, and prevention.

show abstract

“…Before 2013, viruses of at least eight families had been found to infect camels. The recent emergence of Middle East respiratory syndrome coronavirus (MERS-CoV) from the Middle East and the discovery of the virus from nasal samples of dromedaries have boosted interest in the search for novel viruses in dromedaries (de Groot et al, 2013;Lau et al, 2013a;Perera et al, 2013;Reusken et al, 2013;Zaki et al, 2012). Recently, we reported the discovery of a novel dromedary coronavirus, UAE-HKU23, and a novel genotype of hepatitis E virus (HEV) from dromedaries in the Middle East (Woo et al, 2014a, b).…”

Section: Introductionmentioning

confidence: 99%

A novel dromedary camel enterovirus in the family Picornaviridae from dromedaries in the Middle East

Woo

Lau

et al. 2015

Journal of General Virology

Self Cite

View full text Add to dashboard Cite

The recent emergence of Middle East respiratory syndrome coronavirus from the Middle East and the discovery of the virus from dromedary camels have boosted interest in the search for novel viruses in dromedaries. Whilst picornaviruses are known to infect various animals, their existence in dromedaries was unknown. We describe the discovery of a novel picornavirus, dromedary camel enterovirus (DcEV), from dromedaries in Dubai. Among 215 dromedaries, DcEV was detected in faecal samples of four (1.9 %) dromedaries [one (0.5 %) adult dromedary and three (25 %) dromedary calves] by reverse transcription PCR. Analysis of two DcEV genomes showed that DcEV was clustered with other species of the genus Enterovirus and was most closely related to and possessed highest amino acid identities to the species Enterovirus E and Enterovirus F found in cattle. The G+C content of DcEV was 45 mol%, which differed from that of Enterovirus E and Enterovirus F (49-50 mol%) by 4-5 %. Similar to other members of the genus Enterovirus, the 59 UTR of DcEV possessed a putative type I internal ribosome entry site. The low ratios of the number of nonsynonymous substitutions per non-synonymous site to the number of synonymous substitutions per synonymous site (K a /K s ) of various coding regions suggested that dromedaries are the natural reservoir in which DcEV has been stably evolving. These results suggest that DcEV is a novel species of the genus Enterovirus in the family Picornaviridae. Western blot analysis using recombinant DcEV VP1 polypeptide showed a high seroprevalence of 52 % among serum samples from 172 dromedaries for IgG, concurring with its much higher infection rates in dromedary calves than in adults. Further studies are important to understand the pathogenicity, epidemiology and genetic evolution of DcEV in this unique group of animals.

show abstract

Delayed induction of proinflammatory cytokines and suppression of innate antiviral response by the novel Middle East respiratory syndrome coronavirus: implications for pathogenesis and treatment

Cited by 380 publications

References 57 publications

Novel Betacoronavirus in Dromedaries of the Middle East, 2013

Novel Betacoronavirus in Dromedaries of the Middle East, 2013

Middle East respiratory syndrome

A novel dromedary camel enterovirus in the family Picornaviridae from dromedaries in the Middle East

Contact Info

Product

Resources

About