Deletion of a unique loop in the mycobacterial F‐ATP synthase γ subunit sheds light on its inhibitory role in ATP hydrolysis‐driven H⁺ pumping

Abstract

O -ATP synthase is one of the enzymes that is essential to meet the energy requirement of both the proliferating aerobic and hypoxic dormant stages of the life cycle of mycobacteria. Most F-ATP synthases consume ATP in the a 3 :b 3 headpiece to drive the c subunit, which couples ATP cleavage with proton pumping in the c ring of F O via the bottom of the c subunit. ATPase-driven H + pumping is latent in mycobacteria. The presence of a unique 14 amino acid residue loop of the mycobacterial c subunit has been described and aligned in close vicinity to the c-ring loop Priya R et al. (2013) J Bioenerg Biomembr 45, 121-129 Here, we used inverted membrane vesicles (IMVs) of fast-growing Mycobacterium smegmatis and a variety of covalent and non-covalent inhibitors to characterize the ATP hydrolysis activity of the F-ATP synthase inside IMVs. These vesicles formed a platform to investigate the function of the unique mycobaterial c loop by deleting the respective loop-encoding sequence (c [166][167][168][169][170][171][172][173][174][175][176][177][178][179] ) in the genome of M. smegmatis. ATP hydrolysis-driven H + pumping was observed in IMVs containing the Dc 166-179 mutant protein but not for IMVs containing the wild-type F-ATP synthase. In addition, when compared to the wild-type enzyme, IMVs containing the Dc 166-179 mutant protein showed increased ATP cleavage and lower levels of ATP synthesis, demonstrating that the loop affects ATPase activity, ATPase-driven H + pumping and ATP synthesis. These results further indicate that the loop may affect coupling of ATP hydrolysis and synthesis in a different mode.

The NMR solution structure of Mycobacterium tuberculosis F‐ATP synthase subunit ε provides new insight into energy coupling inside the rotary engine

“…The increase in fluorescence observed upon addition of the un-coupler SF6847 confirmed that the IMVs were intact and that the lack of ATP-dependent fluorescence quenching was not the result of leaky IMVs. These data correlate with recent results that showed that ATP hydrolysis catalyzed by the M. smegmatis F-ATP synthase is not coupled to proton-pumping [22,23]. In comparison, addition of ATP to IMVs containing the F-ATP synthase mutant e(W16A) quenched ACMA fluorescence in a manner similar to the WT IMVs.…”

“…The presented data provide also new insights into the binding of the drug BDQ, known to inhibit ATPase activity and ATP synthesis . The drug has been shown to bind with its dimethylamino moiety to residue E65 and sitting with its quinoline moiety on the F69 platform of the mycobacterial c ‐ring .…”

“…The uncoupler ( SF 6847) was added at the indicated time point to collapse the proton gradient. Fluorescence quenching of ACMA by IMV s of the εW16A mutant (green, profile 2) and ε 1‐120 (blue, profile 3) after addition of ATP in comparison to the IMV s of the recently described Δγ166‐179 mutant (red, profile 5) . In the control experiment, buffer was added in place for substrate (gray, profile 1).…”

“…The length of the extended Gs ε CTD (orange line) and Mt ε CTD (cyan line) is marked. (C) A structural model of the α chi 3 β 3 γ‐complex generated based on the G. stearothermophilus F 1 ‐ ATP ase structure ( PDB ID : 4XD7 ). The solution shape of α chi (green sphere) was superimposed on to the Gs α structure (16) (green) and the NMR solution structure of the C‐terminal peptide Mt α 521‐540 (green) was placed in the extra density of the SAXS ‐shape.…”

“…To test the importance of the very C‐terminal residue D121 of Mt ε, we deleted this amino acid by changing the corresponding codon in the genome of M. smegmatis mc 2 155 (ATCC 700084) to a stop codon. Site‐directed, oligonucleotide‐based genome mutagenesis was carried out as described previously . The double stranded DNA oligonucleotide GCGGACCGCGGCATGGGGCCGGGCGCGGCTGCGCGCCCTCGGCCAGATCTAGTAGTCACATCGATGAGCGCGTCCATGATCGGCATGGTCGCGCTCATCG (Integrated DNA Technologies, Singapore) was used to introduce the mutation into codon 121 of the atpC gene, and the introduced mutation was verified by sequencing (AIT Biotech, Singapore).…”