Deletion of the Natural Killer Cell Receptor NKG2C Encoding KLR2C Gene and Kidney Transplant Outcome

Vietzen, Hannes; Döhler, Bernd; Tran, Thuong Hien; Süsal, Caner; Halloran, Philip F.; Eskandary, Farsad; Herz, Carsten Thilo; Mayer, Katharina A.; Kozakowski, Nicolas; Wahrmann, Markus; Ely, Sarah; Haindl, Susanne; Puchhammer‐Stöckl, Elisabeth; Böhmig, Georg A.

doi:10.3389/fimmu.2022.829228

Cited by 16 publications

(10 citation statements)

References 42 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…At 8 weeks, the vascular endothelial cells proliferated and the lumen was narrow, which is a typical pathological injury of rejection. [ 36 ] After treatment with Foe‐TEVs, most glomerulus and renal tubules maintained a normal structure, similar to the sham group and the isograft group ( Figure A). It was noted that glomerular filtration rate (GFR) was elevated more than twofold with Foe‐TEVs treatment both at week 4 and 8 post‐transplant compared with Vector‐TEVs treatment.…”

Section: Resultsmentioning

confidence: 99%

Transcript Engineered Extracellular Vesicles Alleviate Alloreactive Dynamics in Renal Transplantation

Lin

et al. 2022

Advanced Science

View full text Add to dashboard Cite

Direct contact of membrane molecules and cytokine interactions orchestrate immune homeostasis. However, overcoming the threshold of distance and velocity barriers, and achieving adhesion mediated immune interaction remain difficult. Here, inspired by the natural chemotaxis of regulatory T cells, multifunctionalized FOXP3 genetic engineered extracellular vesicles, termed Foe-TEVs, are designed, which display with adhesive molecules, regulatory cytokines, and coinhibitory contact molecules involving CTLA-4 and PD-1, by limited exogenous gene transduction. Foe-TEVs effectively adhere to the tubular, endothelial, and glomerular regions of allogeneic injury in the renal allograft, mitigating cell death in situ and chronic fibrosis transition. Remarkably, transcript engineering reverses the tracking velocity of vesicles to a retained phenotype and enhanced arrest coefficient by a factor of 2.16, directly interacting and attenuating excessive allosensitization kinetics in adaptive lymphoid organs. In murine allogeneic transplantation, immune adhesive Foe-TEVs alleviate pathological responses, restore renal function with well ordered ultrastructure and improved glomerular filtration rate, and prolong the survival period of the recipient from 30.16 to 92.81 days, demonstrating that the delivery of extracellular vesicles, genetically engineered for immune adhesive, is a promising strategy for the treatment of graft rejection.

show abstract

Section: Resultsmentioning

confidence: 99%

Transcript Engineered Extracellular Vesicles Alleviate Alloreactive Dynamics in Renal Transplantation

Lin

et al. 2022

Advanced Science

View full text Add to dashboard Cite

show abstract

“…The KLRC2 wt/del , FcγRIIIa ‐158‐F/V and HLA‐E *0101/0103 variants were genotyped by touchdown PCR or TaqMan assays, respectively, according to recently published protocols. 11 , 12 The rs9916629 ‐ C/T variants were determined by an in‐house TaqMan assay, using rs9916629 ‐ C/T‐specific probes (GCATTATTAATGTA C TAGTTC‐VIC and GCATTATTAATGTA T TAGTTC‐6FAM), primers (Fwd. : CCCTCAAGCTTTCCCCCGTG and Rev: TGCAGTCAGGTTGTTGGGGG) and the Luna Universal Probe qPCR Master Mix (NEB Biolabs), according to the manufacturer's instruction.…”

Section: Methodsmentioning

confidence: 99%

“…Genomic DNA was isolated from respiratory swabs or from plasma samples using NucliSens EasyMag extractor. The KLRC2 wt/del , FcγRIIIa ‐158‐F/V and HLA‐E *0101/0103 variants were genotyped by touchdown PCR or TaqMan assays, respectively, according to recently published protocols 11,12 . The rs9916629 ‐ C/T variants were determined by an in‐house TaqMan assay, using rs9916629 ‐ C/T‐specific probes (GCATTATTAATGTACTAGTTC‐VIC and GCATTATTAATGTATTAGTTC‐6FAM), primers (Fwd.…”

Section: Methodsmentioning

confidence: 99%

The natural killer cell‐associated rs9916629‐C allele is a novel genetic risk factor for fatal COVID‐19

Vietzen

Furlano

Traugott³

et al. 2022

Journal of Medical Virology

Self Cite

View full text Add to dashboard Cite

The severity of COVID‐19 is associated with individual genetic host factors. Among these, genetic polymorphisms affecting natural killer (NK) cell responses, as variations in the HLA‐E‐ (HLA‐E*0101/0103), FcγRIIIa‐ (FcγRIIIa‐158‐F/V), and NKG2C‐ (KLRC2wt/del) receptor, were associated with severe COVID‐19. Recently, the rs9916629‐C/T genetic polymorphism was identified that indirectly shape the human NK cell repertoire towards highly pro‐inflammatory CD56bright NK cells. We investigated whether the rs9916629‐C/T variants alone and in comparison to the other risk factors are associated with a fatal course of COVID‐19. We included 1042 hospitalized surviving and 159 nonsurviving COVID‐19 patients as well as 1000 healthy controls. rs9916629‐C/T variants were genotyped by TaqMan assays and were compared between the groups. The patients' age, comorbidities, HLA‐E*0101/0103, FcγRIIIa‐158‐F/V, and KLRC2wt/del variants were also determined. The presence of the rs9916629‐C allele was a risk factor for severe and fatal COVID‐19 (p < 0.0001), independent of the patients' age or comorbidities. Fatal COVID‐19 was more frequent in younger patients (<69.85 years) carrying the FcγRIIIa‐158‐V/V (p < 0.006) and in older patients expressing the KLRC2del variant (p < 0.003). Thus, patients with the rs9916629‐C allele have a significantly increased risk for fatal COVID‐19 and identification of the genetic variants may be used as prognostic marker for hospitalized COVID‐19 patients.

show abstract

“…In the transplant setting, they are also important mediators of cellular injury 10,11 especially in patients with peritubular capillaritis, a hallmark of antibody-mediated rejection (AMR). [12][13][14]…”

Section: Natural Killer Cellsmentioning

confidence: 99%

Cellular Immunobiology and Molecular Mechanisms in Alloimmunity—Pathways of Immunosuppression

et al. 2023

View full text Add to dashboard Cite

Current maintenance immunosuppression commonly comprises a synergistic combination of tacrolimus as calcineurin inhibitor (CNI), mycophenolic acid, and glucocorticoids. Therapy is often individualized by steroid withdrawal or addition of belatacept or inhibitors of the mechanistic target of rapamycin. This review provides a comprehensive overview of their mode of action, focusing on the cellular immune system. The main pharmacological action of CNIs is suppression of the interleukin-2 pathway that leads to inhibition of T cell activation. Mycophenolic acid inhibits the purine pathway and subsequently diminishes T and B cell proliferation but also exerts a variety of effects on almost all immune cells, including inhibition of plasma cell activity. Glucocorticoids exert complex regulation via genomic and nongenomic mechanisms, acting mainly by downregulating proinflammatory cytokine signatures and cell signaling. Belatacept is potent in inhibiting B/T cell interaction, preventing formation of antibodies; however, it lacks the potency of CNIs in preventing T cell-mediated rejections. Mechanistic target of rapamycin inhibitors have strong antiproliferative activity on all cell types interfering with multiple metabolic pathways, partly explaining poor tolerability, whereas their superior effector T cell function might explain their benefits in the case of viral infections. Over the past decades, clinical and experimental studies provided a good overview on the underlying mechanisms of immunosuppressants. However, more data are needed to delineate the interaction between innate and adaptive immunity to better achieve tolerance and control of rejection. A better and more comprehensive understanding of the mechanistic reasons for failure of immunosuppressants, including individual risk/benefit assessments, may permit improved patient stratification.

show abstract

Deletion of the Natural Killer Cell Receptor NKG2C Encoding KLR2C Gene and Kidney Transplant Outcome

Cited by 16 publications

References 42 publications

Transcript Engineered Extracellular Vesicles Alleviate Alloreactive Dynamics in Renal Transplantation

Transcript Engineered Extracellular Vesicles Alleviate Alloreactive Dynamics in Renal Transplantation

The natural killer cell‐associated rs9916629‐C allele is a novel genetic risk factor for fatal COVID‐19

Cellular Immunobiology and Molecular Mechanisms in Alloimmunity—Pathways of Immunosuppression

Contact Info

Product

Resources

About