Deoxyuridine triphosphates modified with tyrosine or tryptophan aromatic groups for direct electrochemical detection of double-stranded DNA

The Use of Primers Heavily Labeled with Fluorescein in Polymerase Chain Reaction

“…The primers with 6-carboxyfluorescein moieties (FAM) attached to thymine bases were synthesized by "Syntol" (Russia) and listed in Table 1. The 210 base pair (bp) long DNA fragments employed as DNA template (5'-gctggccagtttgctaccttccagtgcagtgccatcggcag gaccgtggcaggagacaggctctggttacagggcattgatgtgcgagatgctcctct gaaggaaatcaaggtgaccagctcccgacgcttcattgcttcatttaatgttgtgaatac caccaaacgagatgctggaaagtaccgctgcatgattcgcactgaaggaggt-3') were produced by PCR from cDNA of transcripts of the human PTPRM gene and purified as earlier described [9]. Real-time PCR was carried out on a DTprime 5M6 thermal cycler ("DNA-Technology", Russia), using the PCR reaction mixture 5X qPCRmix-HS SYBR ("Evrogen", Russia) with Taq polymerase.…”

Normalized Multipotential Redox Coding of DNA Bases for Determination of Total Nucleotide Composition

“…The growing demand for rapid, precise, and cost-effective targeted DNA sequence analysis has resulted in the development of a plethora of platforms for the detection of nucleic acids. , Electrochemical detection is a particularly attractive alternative to optical-based detection methods, due to its high sensitivity, comparatively simple instrumentation, and relatively low cost. , As the reduction and oxidation reactions of nucleobases or their residues require either high negative or high positive potentials, a wide range of diverse labels have been employed for the electrochemical detection of nucleic acids . Several redox labels, including reducible nitroaryl, azidoaryl, or benzofurazane, as well as oxidizable ferrocene derivatives, , methylene blue, − Nile blue, , or tyrosine, , tethered to the nucleobase part of nucleotides have been studied, and some of them have been successfully exploited as labels enzymatically incorporated into DNA for applications in electrochemical (EC) detection and sensing. This gave a rise to an idea of using electrochemical redox labels for multipotential coding of all four nucleobases as an alternative to multicolor-based fluorescence methods, , where an immobilized DNA primer hybridizes to the sequence under interrogation, and the primer is then extended via enzyme-mediated primer extension.…”