Design and Evaluation of a Lactobacillus manihotivorans Species-Specific rRNA-Targeted Hybridization Probe and Its Application to the Study of Sour Cassava Fermentation

Abstract

Based on 16S rRNA sequence comparison, we have designed a 20-mer oligonucleotide that targets a region specific to the species Lactobacillus manihotivorans recently isolated from sour cassava fermentation. The probe recognized the rRNA obtained from all the L. manihotivorans strains tested but did not recognize 56 strains of microorganisms from culture collections or directly isolated from sour cassava, including 29 species of lactic acid bacteria. This probe was then successfully used in quantitative RNA blots and demonstrated the importance of L. manihotivorans in the fermentation of sour cassava starch, which could represent up to 20% of total lactic acid bacteria.

Application of molecular identification tools for Lactobacillus, with a focus on discrimination between closely related species: A review

“…Most often, probes have been designed either against 16S or 23S rRNA genes (Ehrmann, Ludwig, & Schleifer, 1994;Hensiek, Krupp, & Stackebrandt, 1992;Hertel et al, 1991;Sghir, Antonopoulos, & Mackie, 1998), but 16S rRNA based probes remain more popular due to the smaller size of 16S rRNA (1.5 knt) in comparison to the 2.3 knt of the 23S rRNA gene. Species-specific oligonucleotide probes have been used for the successful identification of a number of important Lactobacillus species (Alander et al, 1999;Ampe, 2000;Chagnaud, Machinis, Coutte, Marecat, & Mercenier, 2001;Drake, Small, Spence, & Swanson, 1996;Lucchini et al, 1998;Nakagawa et al, 1994;Park & Itoh, 2005;Pot et al, 1993;Tilsala-Timisjarvi & Alatossava, 1997;Yasui, Okamoto, & Taguchi, 1997). However, probes based on other genes such as pyrDFE have also been successfully applied to resolve the differences among some closely related species (Briengel, Curk, & Hubert, 1996).…”

Article

“…Species can then be distinguished by comparing the V3F/ V3R (GCclamp)CCTACGGGAGGCAGCA/ ATTACCGCGGCTGCTGG V3/16S rDNA [44] gc338f/ 518r (GCclamp)ACGGGGGGACTCCTACGGGAGGCAGCAG/ TCTGTGATGCCCTTAGATGTTCTGGG V3/16S rDNA [5] P1/P2 (GCclamp)TACGGGAGGCAGCAG/ ATTACCGCGGCTGCTGG V3/16S rDNA [39] Lac1/Lac2GC AGCAGTAGGGAATCTTCCA/(GCclamp)ATTYCACCGCTACACATG 16S rDNA [195] Unnamed CGCCGGGGGCGCGCCCCGGGCGGG/ GCGGGGGCACGGGGGG 16S rDNA [150] { Identification of dairy lactobacilli 295 migration distance of the PCR amplicons in gels with those of reference strains [3]. These techniques have recently been used in the evaluation of microbial diversity, particularly the diversity of lactobacilli in cheeses [44,144,150], sausages [39], starch fermentation [5], malt whisky fermentation [186], beer [183], faeces [168,178,195], and the gastrointestinal tract [194], and for the identification of Lactobacillus species [189].…”

Bacterial dynamics during the spontaneous fermentation of cassava dough in gari production

“…These studies examined the microbial community during a submerged fermentation using culture dependent and culture independent methods, specifically using 16SrDNA PCR-DGGE and analyzing the separated 16S rDNA amplimers (Ampe, 1999;Ben Omar & Ampe, 2000). This technique can also be used to study the dynamics of microorganisms involved during the solid substrate traditional fermentation of cassava for gari production, and can be used to compare the profiles of the cultivable bacteria with the non-cultured members of the community.…”