Detection and description of a particular Ostreid herpesvirus 1 genotype associated with massive mortality outbreaks of Pacific oysters, Crassostrea gigas, in France in 2008

Abstract

Ostreid herpesvirus 1 (OsHV-1) infections have been reported around the world and are associated with high mortalities of the Pacific oyster (Crassostrea gigas). In the summer 2008, abnormal mortality rates ranging from 80% to 100% were reported in France and affected only Pacific oysters. Analyses of oyster samples collected during mortality outbreaks demonstrated a significant detection of OsHV-1 (75% of analysed batches), which appeared stronger than previous years. DNA sequencing based on C and IA regions was carried out on 28 batches of OsHV-1 infected Pacific oysters collected in 2008. Polymorphisms were described in both the C and IA regions and characterized a genotype of OsHV-1 not already reported and termed OsHV-1 microVar. A microsatellite zone present in the C region showed several deletions. Additionally, 44 isolates collected in France and in the USA, from 1995 to 2007 were sequenced and compared to the 2008 sequences. The analyses of 76 sequences showed OsHV-1 microVar detection only in 2008 isolates. These data suggest that OsHV-1 microVar can be assumed as an emergent genotype.

Antiviral immunity in marine molluscs

“…distribution range are also naïve to viruses endemic to that region. Not surprisingly, viruses belonging to the Malacoherpesviridae have caused disastrous economic consequences for farmed and wild fisheries (Hooper et al, 2007;Mineur et al, 2015;Segarra et al, 2010). Up to now, the family Malacoherpesviridae incorporates two groups of viruses that are described in further detail below.…”

“…The virus has been purified from naturally infected Crassostrea gigas larvae (Le Deuff & Renault, 1999) and its genome entirely sequenced (Davison et al, 2005). Several genotypes of OsHV-1 have been detected by conventional PCR, targeting a specific area of the genome (Arzul et al, 2001b;Martenot et al, 2011;Segarra et al, 2010). The reference (OsHV-1 ref) and variant (OsHV-1 var.)…”

Molecular diversity and evolution of defensins in the manila clam Ruditapes philippinarum

“…With the rapid development of intensive mariculture, some cultured species have been seriously affected by diseases and mortalities in recent years [39,40]. Therefore, basic knowledge on the innate immunity of commercially important mollusks is urgently needed, especially characterization of the immune-associated molecules and their functions.…”

Ostreid herpesvirus: A pathogen of oysters

“…In 2008 an emerging variant, OsHV-1 µvar was isolated [15]. OsHV-1 μvar, shows a deletion in position 178204-178404 of about 200 bp which probably compromises the protein codified by ORF5, and there is an insertion of 27 bp not present in any published sequence (CCCACTGTGATATCATCGCAAATGAAT ).…”