Detection of black rot disease causing pathogen Xanthomonas campestris pv. campestris by bio-PCR from seeds and plant parts of cole crops

Singh, D. B.; Raghavendra, B. T.; Singh, Prabhakar; Singh, Hemant Kumar; Raghuwanshi, Richa; Singh, Rani

doi:10.15258/sst.2014.42.1.04

Cited by 27 publications

(17 citation statements)

References 0 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Until now, no exhaustive collection, isolation, identification and race characterization of Indian Xcc isolates had been accomplished. In the present study, isolates of Xcc causing black rot were characterized by colony morphology, pathogenicity tests and molecular techniques including PCR of the hrpF gene (Berg et al ., ; Singh & Dhar, ), which is highly conserved and enables differentiation of pathovars (Singh et al ., ). However, the PCR primers Dhrp_Xcc_F and Dhrp_Xcc_R, based on hrp gene sequences, could not differentiate races of Xcc.…”

Section: Discussionmentioning

confidence: 97%

“…Molecular characterization of 217 isolates of Xcc was performed using PCR of a hrp gene, as described by Singh et al . (). Two primers designed to amplify the 3′ end region of the hrpF gene locus 3521496 to 3522264 with product size 769 bp were used: Dhrp_Xcc_F 5′‐GTGGCCATGTCGTCGACTC‐3′ and Dhrp_Xcc_R 5′‐GAATAAACTGTTTCCCCAATG‐3′.…”

Section: Methodsmentioning

confidence: 97%

See 1 more Smart Citation

Characterization, genetic diversity and distribution of Xanthomonas campestris pv. campestris races causing black rot disease in cruciferous crops of India

2016

Self Cite

View full text Add to dashboard Cite

Black rot, caused by Xanthomonas campestris pv. campestris (Xcc) is a disease of crucifer crops. The objective of this study was to characterize races of Xcc, their distribution and genetic diversity in India. Two hundred and seventeen isolates of bacteria were obtained from 12 different black rot‐infected crucifer crops from 19 states of India; these were identified as Xcc based on morphology, hrpF gene and 16S rRNA gene based molecular markers and pathogenicity tests. Characterization of races was performed by using a set of seven differential crucifer hosts, comprising two cultivars of turnip (Brassica rapa var. rapa) and cultivars of Indian mustard (B. juncea), Ethiopian mustard (B. carinata), rapeseed mustard (B. napus), cauliflower (B. oleracea) and Savoy cabbage (B. oleracea var. sabauda). Races 1, 4 and 6 of Xcc were identified and, among these races, race 1 followed by race 4 dominated most of the states of India. Genetic diversity of the Indian isolates of Xcc was analysed using repetitive sequence‐based PCR (rep‐PCR) including primers for REP (repetitive extragenic palindromic), ERIC (enterobacterial repetitive intergenic consensus) and BOX (amplifying with BOX A1 R primer) repetitive elements. This method of fingerprinting grouped the isolates into 56 different DNA types (clusters) with a 75% similarity coefficient. Among these clusters, DNA types 22 and 53 contained two different races 1 and 4, whereas DNA type 12 contained races 1, 4 and 6. However, no clear relationship was observed between fingerprints and races, hosts or geographical origin.

show abstract

Section: Discussionmentioning

confidence: 97%

Section: Methodsmentioning

confidence: 97%

Characterization, genetic diversity and distribution of Xanthomonas campestris pv. campestris races causing black rot disease in cruciferous crops of India

2016

Self Cite

View full text Add to dashboard Cite

show abstract

“…The isolates of Xcc were collected from 12 agro-climatic regions under 18 states of India from 8 crucifer crops. In the present studies, black rot producing isolates of Xcc were characterized by pathogenicity test and advanced technique like PCR based molecular technique using 16srRNA, efP, hrp gene [13,14] which is to highly conserved to enable differentiation of the pathovars [20]). All the isolates were identical in classical tests and produced typical black rot disease symptom as V-shaped yellowing and necrosis of tissue and blackening of veins.…”

Section: Discussionmentioning

confidence: 99%

“…The total genomic DNA of the bacteria was extracted using the CTAB method [19]. Molecular characterisation of 75 isolates of Xcc was achieved using a hrpF gene based PCR as described by Singh et al [20].…”

Section: Dna Extraction and Molecular Characterisationmentioning

confidence: 99%

“…PCR was carried out under the following conditions using a Gradient thermocycler (C-1000TM, BIORAD): 95°C for two min followed by 30 cycles of 95°C for 30 seconds, annealing temperature and duration was varied according to gene (Table 2), 72°C for 1 min and terminated by a final elongation at 72°C for five min. The hrpF gene primers and protocol used were as described by Singh et al [20]. The PCR product was mixed with 1.0 μl of loading dye.…”

Section: Multilocus Sequence Analysismentioning

confidence: 99%

See 1 more Smart Citation

Pathogenic and Genetic Characterization of Xanthomonas campestris Pv. campestris Races Based on Rep-PCR and Multilocus Sequence Analysis

Rathaur¹,

Singh²,

Raghuwanshi³

2015

J Plant Pathol Microbiol

View full text Add to dashboard Cite

Xanthomonas campestris pv. campestris (Pammel) Dowson (Xcc) is the causal agent of black rot disease of crucifers worldwide. Seventy five isolates of Xcc were collected from 12 agro-climatic regions of India to determine the distribution pattern of races and diversity of the population. Based on pathogenic reaction on seven standard differential crucifers, race 1, 4 & 6 were found to be prevalent. For assessing the pathogenic diversity, forty one cultivars of crucifers comprising seven Brassica and coeno species were inoculated artificially under field conditions. Brassica juncea cultivars (Pusa Bold, Varuna, Pusa Vijay, Pusa Mustard 21 and Pusa Mustard 25) showed resistance against all the strains of Xcc, whereas the Brassica olerecea cultivar Pusa Ageti was found to be resistant to races 1 and 4. Genetic characterization of these 75 strains of Xcc was carried out using rep-PCR (ERIC, REP and BOX-PCRs) followed by phylogenetic analysis. The strains of Xcc clustered into 6 groups at 50% similarity coefficient and among these groups, 28 strains of Xcc belonging to races 1, 4 & 6 were clustered together under Group 5. Sequences of the 16S rRNA, hrpF and efP genes of five strains representing the races 1, 4 and 6 were used for multilocus sequence analysis. Based on sequence analysis of 16S rRNA and hrpF genes, the Indian strains were found to be very closely related to the strain Xcc ATCC 33913 (race 3, UK), whereas based on efP sequences, they were found to be closely related to strains race 1 Xcc B100 (Italy) and race 9 Xcc 8004 (UK).

show abstract

Detection and Identification of Bacterial and Phytoplasmal Pathogens

2017

Microbial Plant Pathogens

View full text Add to dashboard Cite

Detection of black rot disease causing pathogen Xanthomonas campestris pv. campestris by bio-PCR from seeds and plant parts of cole crops

Cited by 27 publications

References 0 publications

Characterization, genetic diversity and distribution of Xanthomonas campestris pv. campestris races causing black rot disease in cruciferous crops of India

Characterization, genetic diversity and distribution of Xanthomonas campestris pv. campestris races causing black rot disease in cruciferous crops of India

Pathogenic and Genetic Characterization of Xanthomonas campestris Pv. campestris Races Based on Rep-PCR and Multilocus Sequence Analysis

Detection and Identification of Bacterial and Phytoplasmal Pathogens

Contact Info

Product

Resources

About