Detection of bovine trichomoniasis with a specific DNA probe and PCR amplification system

Abstract

Trichomoniasis is a widespread, economically important venereal disease of cattle which causes infertility and abortion. Effective control of trichomoniasis has been impeded by the insensitivity of traditional diagnostic procedures, which require the isolation and cultivation of the parasite, 7Titrichomonasfoetus, from infected cattle. We developed a 0.85-kb T.foetus DNA probe by identifying conserved sequences in DNAs from T.foetus that were isolated from cattle in California, Idaho, Nevada, and Costa Rica. The probe hybridized specifically to DNAs of T. foetus isolates from different geographic areas but not to DNA preparations of Trichomonas vaginalis, bovine cells, or a variety of bacteria from cattle. The probe detected DNA from a minimum of i05 T.foetus organisms. To improve sensitivity, a partial sequence of the probe was used to identify oligonucleotide primers (TF1 and TF2) which could be used to amplify a 162-bp product from T. foetus DNAs by PCR. A chemiluminescent internal T. foetus sequence probe was hybridized to Southern blots of the amplification product. This system detected as few as one T. foetus organism in culture media or 10 parasites in samples containing bovine preputial smegma. Analysis of 52 clinical samples showed that 47 (90.4%) of the 52 samples were correctly identified, with no false-positive reactions. In comparison, the traditional cultivation method detected 44 (84.6%) of the 52 samples from T. foetus-infected and uninfected bulls. These results indicate that the PCR-based amplification system could be a useful alternative method for the diagnosis of bovine trichomoniasis.

PCR-based study of conserved and variable DNA sequences of Tritrichomonas foetus isolates from Saskatchewan, Canada

“…DNA was purified from the 16 Saskatchewan isolates and the American Type Culture Collection Austrian isolate, 50151. These DNAs were subjected to the T. foetus-specific single-band PCR test of Ho et al (9). The expected 162-bp PCR product was strongly amplified from 16 isolate DNAs (Fig.…”

“…Oligonucleotide primers were synthesized with a Cyclone DNA synthesizer (Millipore, Bedford, Mass.). The TF1-TF2 single-band PCR test used published primer sequences (9). TCO-1 amplifications used the 57-mer, GGATCCATCGGAATTAAAAAACCGAAAAA AAAATTTAGGGTAAAAAAAATCATTACA, complementary to the control region of a trichomonad cell division control-like sequence (20).…”

“…DNA was purified from two T. vaginalis isolates and one T. foetus American Type Culture Collection isolate and from cultures of preputial washes of 16 bulls from the province of Saskatchewan, Canada. Ten nanograms of each DNA was subjected to PCR using primers TF1 and TF2 (9). PCR products were electrophoresed in 1.4% agarose for 3.5 h at 90 V and then subjected to ethidium bromide staining, UV illumination, and photography.…”

What is known about Tritrichomonas foetus infection in cats?

“…A large variety of molecular protocols were developed for the detection of T. foetus in cattle and felines (HO et al, 1994;FELLEISEN et al, 1998;GOOKIN et al, 2002;BONDURANT et al, 2003;GRAHN et al, 2005). Many tests rely on amplification of the 5.8S rRNA gene sequences using ITS1 and ITS2, which are more conserved regions among isolates (FELLEISEN, 1997).…”

Bovine vaginal antibody responses to immunoaffinity-purified surface antigen of Tritrichomonas foetus

“…The sensitivity of this assay has been controversial since a subsequent study reported that of 26 culture-positive bulls only 10 or 14 animals were identified as being infected by the DNA probe assay (1). More recently, using PCR amplification of repetitive genomic sequences of DNA, Ho and coworkers (11) were able to identify 90% of infected samples from naturally infected bulls, while uninfected bulls were all classified as negative with the same PCR probe. This is promising.…”