Detection of hepatitis C virus RNA in patients with chronic hepatitis C virus infections during and after therapy with alpha interferon

Abstract

In 24 patients with hepatitic C virus (HCV) infection who participated in a randomized trial with alpha 2B interferon, HCV RNA analysis by the polymerase chain reaction with two separate primer sets was performed at weeks 0, 4, and 24 and during a follow-up period of 6 to 9 months. Prior to therapy all patients were HCV RNA positive. During therapy, HCV RNA decreased to an undetectable level (<1 chimpanzee infectious dose per ml) in nine patients at week 4. After week 4, no additional cases of HCV RNA disappearance (<1 chimpanzee infectious dose per ml) were observed. During follow-up, HCV RNA could not be detected in four of the six patients with a sustained alanine aminotransferase response. These results suggest the probable predictive value of HCV RNA levels for detecting the failure of therapy in an early stage of HCV infection.In recent years, several randomized controlled studies were performed with alpha interferon (IFN) for the treatment of non-A, non-B hepatitis (NANBH) (9,10,13,16,19,20). The effect of IFN was evaluated by measuring the alanine aminotransferase (ALT) level in serum, which reflects the activity of liver disease.Recently, the etiological agent for NANBH has been identified (6, 12). The causative agent is now known as hepatitis C virus (HCV). The HCV genome is a positivestranded RNA molecule of about 9,400 nucleotides. Sequence homology among the known HCV strains is about 80% (3, 7, 14, 17, 21).In the study described here, 24 patients were investigated for the presence of HCV RNA during and after IFN therapy, to determine directly the effect of IFN treatment on viremia. HCV RNA analysis by the polymerase chain reaction was performed by using primer sets from the highly conserved noncoding (NC) region and a conserved sequence from nonstructural region 5 (NS5).Patients between 18 and 70 years of age with elevated ALT levels (22 times the upper limit of normal), a biopsyproven chronic NANBH, antibodies to HCV determined by a second-generation enzyme immunosorbent assay (Abbott, North Chicago, Ill.) and a confirmatory assay RIBA IV (Ortho, Raritan, N.J.), and no recent history of hepatitis B virus, hepatitis A virus, cytomegalovirus, or Epstein-Barr virus infection were included in the study. All patients gave informed consent prior to participation in the study. Patients were treated in a randomized controlled trial with either a standard scheme (12 patients) consisting of 3 MU of recombinant IFN-a2B (Intron A; Schering Plough, Kenilworth, N.J.) three times a week for 24 weeks or an experimental scheme (12 patients). In the experimental scheme, therapy was started with 6 MU of recombinant IFN-ot2B three times a week for at least 8 weeks. Therapy was stopped at week 12 if ALT levels remained elevated. If the ALT level normalized, therapy was continued with 3 MU of recombinant IFN-ot2B three times a week for 8 weeks; this was followed * Corresponding author. 595by treatment with 1 MU of recombinant IFN-ox2B three times a week until a normal ALT level was accompanied by an undetectable HCV RN...

Estimation of Early Hepatitis C Viral Clearance in Patients Receiving Daily Interferon and Ribavirin Therapy Using A Mathematical Model

“…[4][5][6][7][8] Also, an acute dose response has been reported with higher daily doses of IFN in chronic hepatitis C, and a biphasic exponential viral decline has been described in chronic HCV infection during therapy. [5][6][7] In addition, most patients who achieve a sustained virologic response to antiviral therapy do so early during treatment (in general before week 12), [9][10][11][12][13] and a greater than 3 log reduction in serum HCV RNA early during therapy has been reported to be a good predictor of eventual sustained response. 14 Early clearance of HCV may also theoretically prevent the development of resistant quasispecies.…”

Sequence analysis of hepatitis C virus genotypes 1 to 5 reveals multiple novel subtypes in the Benelux countries

“…HCV RNA was isolated by a modification of the guanidinium isothiocyanate method (Chomczynski & Sacchi, 1987;Kleter et al, 1993). Detection of HCV RNA was performed by RT-PCR with primers HCV35 (sense, positions -318 to -296; 5' TTGGCGGCCG CACTCCACCATGAATCACTCCCC 3'; underlined sequence is non-HCV specific) and HCV19 (antisense, 0001-3054 © 1995 SGM positions -1 to -20; 5' GTGCACGGTCTACGA-GACCT 3').…”

Treatment of hepatitis C with interferon and ribavirin

“…Early clearance of serum HCV‐RNA (week 4) has been shown to be a variable predictor of sustained response to IFN therapy 18,19 and was also observed in the USA study. 9 However, late initial viral clearance at week 12 or 24 was associated with sustained long‐term virological clearance in both the combination therapy group (59%) and in the IFN only group (52%) treated for 48 weeks.…”